ID: 1199655576

View in Genome Browser
Species Human (GRCh38)
Location X:149991745-149991767
Sequence GAAGCACTTAAAACAAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199655569_1199655576 25 Left 1199655569 X:149991697-149991719 CCTTTTCCTCATGAGGTCAGTGT No data
Right 1199655576 X:149991745-149991767 GAAGCACTTAAAACAAGGCCTGG No data
1199655572_1199655576 19 Left 1199655572 X:149991703-149991725 CCTCATGAGGTCAGTGTGGGTAC No data
Right 1199655576 X:149991745-149991767 GAAGCACTTAAAACAAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199655576 Original CRISPR GAAGCACTTAAAACAAGGCC TGG Intergenic
No off target data available for this crispr