ID: 1199656432

View in Genome Browser
Species Human (GRCh38)
Location X:149999616-149999638
Sequence GTGCTGAACAGGTCAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199656432_1199656436 9 Left 1199656432 X:149999616-149999638 CCTTCCTCTGACCTGTTCAGCAC No data
Right 1199656436 X:149999648-149999670 TGACATGGAGAGACCACCGATGG No data
1199656432_1199656437 18 Left 1199656432 X:149999616-149999638 CCTTCCTCTGACCTGTTCAGCAC No data
Right 1199656437 X:149999657-149999679 GAGACCACCGATGGCCTGTGAGG No data
1199656432_1199656435 -6 Left 1199656432 X:149999616-149999638 CCTTCCTCTGACCTGTTCAGCAC No data
Right 1199656435 X:149999633-149999655 CAGCACTGTCAAGAGTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199656432 Original CRISPR GTGCTGAACAGGTCAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr