ID: 1199656912

View in Genome Browser
Species Human (GRCh38)
Location X:150005543-150005565
Sequence GTGTCAGAATATTCATCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199656910_1199656912 -3 Left 1199656910 X:150005523-150005545 CCATCTTCAGATGCGTGTGGGTG No data
Right 1199656912 X:150005543-150005565 GTGTCAGAATATTCATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199656912 Original CRISPR GTGTCAGAATATTCATCTTT GGG Intergenic
No off target data available for this crispr