ID: 1199663405

View in Genome Browser
Species Human (GRCh38)
Location X:150076744-150076766
Sequence CCCTGTGCCCCTTTATAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199663402_1199663405 15 Left 1199663402 X:150076706-150076728 CCATTTGGATATCTTATCTGGAG No data
Right 1199663405 X:150076744-150076766 CCCTGTGCCCCTTTATAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199663405 Original CRISPR CCCTGTGCCCCTTTATAATA GGG Intergenic
No off target data available for this crispr