ID: 1199664665

View in Genome Browser
Species Human (GRCh38)
Location X:150087210-150087232
Sequence AACTTAGATACTCTGCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199664665_1199664668 29 Left 1199664665 X:150087210-150087232 CCTGCTAGCAGAGTATCTAAGTT No data
Right 1199664668 X:150087262-150087284 CTACCTAGAAACAGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199664665 Original CRISPR AACTTAGATACTCTGCTAGC AGG (reversed) Intergenic
No off target data available for this crispr