ID: 1199664668

View in Genome Browser
Species Human (GRCh38)
Location X:150087262-150087284
Sequence CTACCTAGAAACAGACCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199664664_1199664668 30 Left 1199664664 X:150087209-150087231 CCCTGCTAGCAGAGTATCTAAGT No data
Right 1199664668 X:150087262-150087284 CTACCTAGAAACAGACCCACAGG No data
1199664665_1199664668 29 Left 1199664665 X:150087210-150087232 CCTGCTAGCAGAGTATCTAAGTT No data
Right 1199664668 X:150087262-150087284 CTACCTAGAAACAGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199664668 Original CRISPR CTACCTAGAAACAGACCCAC AGG Intergenic
No off target data available for this crispr