ID: 1199665419

View in Genome Browser
Species Human (GRCh38)
Location X:150092785-150092807
Sequence CAGTCATAATGGCCCTCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199665411_1199665419 8 Left 1199665411 X:150092754-150092776 CCAGCGGTATCCAGGAAACCCCA No data
Right 1199665419 X:150092785-150092807 CAGTCATAATGGCCCTCAAGAGG No data
1199665414_1199665419 -10 Left 1199665414 X:150092772-150092794 CCCCAAGAGTGGCCAGTCATAAT No data
Right 1199665419 X:150092785-150092807 CAGTCATAATGGCCCTCAAGAGG No data
1199665410_1199665419 9 Left 1199665410 X:150092753-150092775 CCCAGCGGTATCCAGGAAACCCC No data
Right 1199665419 X:150092785-150092807 CAGTCATAATGGCCCTCAAGAGG No data
1199665408_1199665419 17 Left 1199665408 X:150092745-150092767 CCTTGGTTCCCAGCGGTATCCAG No data
Right 1199665419 X:150092785-150092807 CAGTCATAATGGCCCTCAAGAGG No data
1199665413_1199665419 -2 Left 1199665413 X:150092764-150092786 CCAGGAAACCCCAAGAGTGGCCA No data
Right 1199665419 X:150092785-150092807 CAGTCATAATGGCCCTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199665419 Original CRISPR CAGTCATAATGGCCCTCAAG AGG Intergenic
No off target data available for this crispr