ID: 1199665824

View in Genome Browser
Species Human (GRCh38)
Location X:150095659-150095681
Sequence CAGAGTCAGGAGGAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199665824_1199665829 2 Left 1199665824 X:150095659-150095681 CCACCATCCTCCTCCTGACTCTG No data
Right 1199665829 X:150095684-150095706 AGCCCCTATTGCCTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199665824 Original CRISPR CAGAGTCAGGAGGAGGATGG TGG (reversed) Intergenic
No off target data available for this crispr