ID: 1199667356

View in Genome Browser
Species Human (GRCh38)
Location X:150108598-150108620
Sequence TGAAACTGTTTGGGTAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199667353_1199667356 -9 Left 1199667353 X:150108584-150108606 CCTCGTCTATTTTCTGAAACTGT No data
Right 1199667356 X:150108598-150108620 TGAAACTGTTTGGGTAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199667356 Original CRISPR TGAAACTGTTTGGGTAAAAT TGG Intergenic
No off target data available for this crispr