ID: 1199668126

View in Genome Browser
Species Human (GRCh38)
Location X:150118410-150118432
Sequence GAGGAACTGTCAAATGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199668126_1199668129 -5 Left 1199668126 X:150118410-150118432 CCATTATCATTTGACAGTTCCTC No data
Right 1199668129 X:150118428-150118450 TCCTCTGGGAAAGTTTACCCAGG No data
1199668126_1199668133 4 Left 1199668126 X:150118410-150118432 CCATTATCATTTGACAGTTCCTC No data
Right 1199668133 X:150118437-150118459 AAAGTTTACCCAGGGACTCTGGG No data
1199668126_1199668131 -4 Left 1199668126 X:150118410-150118432 CCATTATCATTTGACAGTTCCTC No data
Right 1199668131 X:150118429-150118451 CCTCTGGGAAAGTTTACCCAGGG No data
1199668126_1199668134 5 Left 1199668126 X:150118410-150118432 CCATTATCATTTGACAGTTCCTC No data
Right 1199668134 X:150118438-150118460 AAGTTTACCCAGGGACTCTGGGG No data
1199668126_1199668132 3 Left 1199668126 X:150118410-150118432 CCATTATCATTTGACAGTTCCTC No data
Right 1199668132 X:150118436-150118458 GAAAGTTTACCCAGGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199668126 Original CRISPR GAGGAACTGTCAAATGATAA TGG (reversed) Intergenic
No off target data available for this crispr