ID: 1199668132

View in Genome Browser
Species Human (GRCh38)
Location X:150118436-150118458
Sequence GAAAGTTTACCCAGGGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199668125_1199668132 13 Left 1199668125 X:150118400-150118422 CCATTCATGGCCATTATCATTTG No data
Right 1199668132 X:150118436-150118458 GAAAGTTTACCCAGGGACTCTGG No data
1199668126_1199668132 3 Left 1199668126 X:150118410-150118432 CCATTATCATTTGACAGTTCCTC No data
Right 1199668132 X:150118436-150118458 GAAAGTTTACCCAGGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199668132 Original CRISPR GAAAGTTTACCCAGGGACTC TGG Intergenic
No off target data available for this crispr