ID: 1199668132 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:150118436-150118458 |
| Sequence | GAAAGTTTACCCAGGGACTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199668125_1199668132 | 13 | Left | 1199668125 | X:150118400-150118422 | CCATTCATGGCCATTATCATTTG | No data | ||
| Right | 1199668132 | X:150118436-150118458 | GAAAGTTTACCCAGGGACTCTGG | No data | ||||
| 1199668126_1199668132 | 3 | Left | 1199668126 | X:150118410-150118432 | CCATTATCATTTGACAGTTCCTC | No data | ||
| Right | 1199668132 | X:150118436-150118458 | GAAAGTTTACCCAGGGACTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199668132 | Original CRISPR | GAAAGTTTACCCAGGGACTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||