ID: 1199671078

View in Genome Browser
Species Human (GRCh38)
Location X:150148822-150148844
Sequence GGGCCACAGCACCACAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199671078_1199671084 13 Left 1199671078 X:150148822-150148844 CCACCACTGTGGTGCTGTGGCCC No data
Right 1199671084 X:150148858-150148880 AGGAGCACTTTCCAGCTCCTTGG No data
1199671078_1199671080 -7 Left 1199671078 X:150148822-150148844 CCACCACTGTGGTGCTGTGGCCC No data
Right 1199671080 X:150148838-150148860 GTGGCCCAACTGTCTCCTGAAGG No data
1199671078_1199671086 28 Left 1199671078 X:150148822-150148844 CCACCACTGTGGTGCTGTGGCCC No data
Right 1199671086 X:150148873-150148895 CTCCTTGGCTATAGCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199671078 Original CRISPR GGGCCACAGCACCACAGTGG TGG (reversed) Intergenic
No off target data available for this crispr