ID: 1199673775

View in Genome Browser
Species Human (GRCh38)
Location X:150167321-150167343
Sequence GCAATTGCACAGATGCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199673775_1199673777 23 Left 1199673775 X:150167321-150167343 CCATGATGCATCTGTGCAATTGC No data
Right 1199673777 X:150167367-150167389 ATCAATGAACATGTGCCAGAAGG No data
1199673775_1199673778 24 Left 1199673775 X:150167321-150167343 CCATGATGCATCTGTGCAATTGC No data
Right 1199673778 X:150167368-150167390 TCAATGAACATGTGCCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199673775 Original CRISPR GCAATTGCACAGATGCATCA TGG (reversed) Intergenic
No off target data available for this crispr