ID: 1199676037

View in Genome Browser
Species Human (GRCh38)
Location X:150190079-150190101
Sequence GCTCATCTAAAGGACTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199676037_1199676046 9 Left 1199676037 X:150190079-150190101 CCACCAAAGTCCTTTAGATGAGC No data
Right 1199676046 X:150190111-150190133 TCCTCCAAACGGCTGCTAGTGGG No data
1199676037_1199676045 8 Left 1199676037 X:150190079-150190101 CCACCAAAGTCCTTTAGATGAGC No data
Right 1199676045 X:150190110-150190132 CTCCTCCAAACGGCTGCTAGTGG No data
1199676037_1199676050 20 Left 1199676037 X:150190079-150190101 CCACCAAAGTCCTTTAGATGAGC No data
Right 1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG No data
1199676037_1199676041 -2 Left 1199676037 X:150190079-150190101 CCACCAAAGTCCTTTAGATGAGC No data
Right 1199676041 X:150190100-150190122 GCTGGATCCCCTCCTCCAAACGG No data
1199676037_1199676049 17 Left 1199676037 X:150190079-150190101 CCACCAAAGTCCTTTAGATGAGC No data
Right 1199676049 X:150190119-150190141 ACGGCTGCTAGTGGGACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199676037 Original CRISPR GCTCATCTAAAGGACTTTGG TGG (reversed) Intergenic
No off target data available for this crispr