ID: 1199676047

View in Genome Browser
Species Human (GRCh38)
Location X:150190112-150190134
Sequence TCCCACTAGCAGCCGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199676047_1199676052 19 Left 1199676047 X:150190112-150190134 CCTCCAAACGGCTGCTAGTGGGA No data
Right 1199676052 X:150190154-150190176 CAGCTGTATGAGTTTGTAAAAGG No data
1199676047_1199676053 20 Left 1199676047 X:150190112-150190134 CCTCCAAACGGCTGCTAGTGGGA No data
Right 1199676053 X:150190155-150190177 AGCTGTATGAGTTTGTAAAAGGG No data
1199676047_1199676054 26 Left 1199676047 X:150190112-150190134 CCTCCAAACGGCTGCTAGTGGGA No data
Right 1199676054 X:150190161-150190183 ATGAGTTTGTAAAAGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199676047 Original CRISPR TCCCACTAGCAGCCGTTTGG AGG (reversed) Intergenic
No off target data available for this crispr