ID: 1199676048

View in Genome Browser
Species Human (GRCh38)
Location X:150190115-150190137
Sequence GTGTCCCACTAGCAGCCGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199676048_1199676052 16 Left 1199676048 X:150190115-150190137 CCAAACGGCTGCTAGTGGGACAC No data
Right 1199676052 X:150190154-150190176 CAGCTGTATGAGTTTGTAAAAGG No data
1199676048_1199676053 17 Left 1199676048 X:150190115-150190137 CCAAACGGCTGCTAGTGGGACAC No data
Right 1199676053 X:150190155-150190177 AGCTGTATGAGTTTGTAAAAGGG No data
1199676048_1199676054 23 Left 1199676048 X:150190115-150190137 CCAAACGGCTGCTAGTGGGACAC No data
Right 1199676054 X:150190161-150190183 ATGAGTTTGTAAAAGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199676048 Original CRISPR GTGTCCCACTAGCAGCCGTT TGG (reversed) Intergenic
No off target data available for this crispr