ID: 1199676050

View in Genome Browser
Species Human (GRCh38)
Location X:150190122-150190144
Sequence GCTGCTAGTGGGACACTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199676038_1199676050 17 Left 1199676038 X:150190082-150190104 CCAAAGTCCTTTAGATGAGCTGG No data
Right 1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG No data
1199676043_1199676050 -9 Left 1199676043 X:150190108-150190130 CCCTCCTCCAAACGGCTGCTAGT No data
Right 1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG No data
1199676036_1199676050 27 Left 1199676036 X:150190072-150190094 CCTTGGGCCACCAAAGTCCTTTA No data
Right 1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG No data
1199676035_1199676050 28 Left 1199676035 X:150190071-150190093 CCCTTGGGCCACCAAAGTCCTTT No data
Right 1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG No data
1199676040_1199676050 10 Left 1199676040 X:150190089-150190111 CCTTTAGATGAGCTGGATCCCCT No data
Right 1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG No data
1199676044_1199676050 -10 Left 1199676044 X:150190109-150190131 CCTCCTCCAAACGGCTGCTAGTG No data
Right 1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG No data
1199676042_1199676050 -8 Left 1199676042 X:150190107-150190129 CCCCTCCTCCAAACGGCTGCTAG No data
Right 1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG No data
1199676037_1199676050 20 Left 1199676037 X:150190079-150190101 CCACCAAAGTCCTTTAGATGAGC No data
Right 1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199676050 Original CRISPR GCTGCTAGTGGGACACTAGG AGG Intergenic
No off target data available for this crispr