ID: 1199676052

View in Genome Browser
Species Human (GRCh38)
Location X:150190154-150190176
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199676042_1199676052 24 Left 1199676042 X:150190107-150190129 CCCCTCCTCCAAACGGCTGCTAG No data
Right 1199676052 X:150190154-150190176 CAGCTGTATGAGTTTGTAAAAGG No data
1199676044_1199676052 22 Left 1199676044 X:150190109-150190131 CCTCCTCCAAACGGCTGCTAGTG No data
Right 1199676052 X:150190154-150190176 CAGCTGTATGAGTTTGTAAAAGG No data
1199676043_1199676052 23 Left 1199676043 X:150190108-150190130 CCCTCCTCCAAACGGCTGCTAGT No data
Right 1199676052 X:150190154-150190176 CAGCTGTATGAGTTTGTAAAAGG No data
1199676048_1199676052 16 Left 1199676048 X:150190115-150190137 CCAAACGGCTGCTAGTGGGACAC No data
Right 1199676052 X:150190154-150190176 CAGCTGTATGAGTTTGTAAAAGG No data
1199676047_1199676052 19 Left 1199676047 X:150190112-150190134 CCTCCAAACGGCTGCTAGTGGGA No data
Right 1199676052 X:150190154-150190176 CAGCTGTATGAGTTTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199676052 Original CRISPR CAGCTGTATGAGTTTGTAAA AGG Intergenic
No off target data available for this crispr