ID: 1199676054

View in Genome Browser
Species Human (GRCh38)
Location X:150190161-150190183
Sequence ATGAGTTTGTAAAAGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199676047_1199676054 26 Left 1199676047 X:150190112-150190134 CCTCCAAACGGCTGCTAGTGGGA No data
Right 1199676054 X:150190161-150190183 ATGAGTTTGTAAAAGGGCAGAGG No data
1199676048_1199676054 23 Left 1199676048 X:150190115-150190137 CCAAACGGCTGCTAGTGGGACAC No data
Right 1199676054 X:150190161-150190183 ATGAGTTTGTAAAAGGGCAGAGG No data
1199676044_1199676054 29 Left 1199676044 X:150190109-150190131 CCTCCTCCAAACGGCTGCTAGTG No data
Right 1199676054 X:150190161-150190183 ATGAGTTTGTAAAAGGGCAGAGG No data
1199676043_1199676054 30 Left 1199676043 X:150190108-150190130 CCCTCCTCCAAACGGCTGCTAGT No data
Right 1199676054 X:150190161-150190183 ATGAGTTTGTAAAAGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199676054 Original CRISPR ATGAGTTTGTAAAAGGGCAG AGG Intergenic
No off target data available for this crispr