ID: 1199677196

View in Genome Browser
Species Human (GRCh38)
Location X:150198688-150198710
Sequence TCAGGTGCCTCCTGTGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199677194_1199677196 -8 Left 1199677194 X:150198673-150198695 CCTCTTTGCCTGAGATCAGGTGC No data
Right 1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG No data
1199677187_1199677196 15 Left 1199677187 X:150198650-150198672 CCCTTGCCTAGCCCCACTGGTGT No data
Right 1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG No data
1199677188_1199677196 14 Left 1199677188 X:150198651-150198673 CCTTGCCTAGCCCCACTGGTGTC No data
Right 1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG No data
1199677192_1199677196 2 Left 1199677192 X:150198663-150198685 CCACTGGTGTCCTCTTTGCCTGA No data
Right 1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG No data
1199677189_1199677196 9 Left 1199677189 X:150198656-150198678 CCTAGCCCCACTGGTGTCCTCTT No data
Right 1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG No data
1199677191_1199677196 3 Left 1199677191 X:150198662-150198684 CCCACTGGTGTCCTCTTTGCCTG No data
Right 1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG No data
1199677190_1199677196 4 Left 1199677190 X:150198661-150198683 CCCCACTGGTGTCCTCTTTGCCT No data
Right 1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG No data
1199677185_1199677196 22 Left 1199677185 X:150198643-150198665 CCAGGGACCCTTGCCTAGCCCCA No data
Right 1199677196 X:150198688-150198710 TCAGGTGCCTCCTGTGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199677196 Original CRISPR TCAGGTGCCTCCTGTGTAGC AGG Intergenic
No off target data available for this crispr