ID: 1199679259

View in Genome Browser
Species Human (GRCh38)
Location X:150214269-150214291
Sequence GGTGATCCCCAATATACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199679259_1199679262 -2 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679262 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
1199679259_1199679264 6 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679264 X:150214298-150214320 GCATCTCCTCACTGGTCTCCAGG No data
1199679259_1199679266 10 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679266 X:150214302-150214324 CTCCTCACTGGTCTCCAGGTGGG No data
1199679259_1199679268 19 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679268 X:150214311-150214333 GGTCTCCAGGTGGGCCTCAGTGG No data
1199679259_1199679265 9 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679265 X:150214301-150214323 TCTCCTCACTGGTCTCCAGGTGG No data
1199679259_1199679269 20 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679269 X:150214312-150214334 GTCTCCAGGTGGGCCTCAGTGGG No data
1199679259_1199679272 27 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679272 X:150214319-150214341 GGTGGGCCTCAGTGGGAGGTAGG No data
1199679259_1199679270 23 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679270 X:150214315-150214337 TCCAGGTGGGCCTCAGTGGGAGG No data
1199679259_1199679273 30 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679273 X:150214322-150214344 GGGCCTCAGTGGGAGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199679259 Original CRISPR GGTGATCCCCAATATACATC TGG (reversed) Intergenic