ID: 1199679261

View in Genome Browser
Species Human (GRCh38)
Location X:150214290-150214312
Sequence CCAGTGAGGAGATGCCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199679261_1199679276 28 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679276 X:150214341-150214363 GAGGGCAAAGACTGAAGTCCAGG No data
1199679261_1199679273 9 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679273 X:150214322-150214344 GGGCCTCAGTGGGAGGTAGGAGG No data
1199679261_1199679269 -1 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679269 X:150214312-150214334 GTCTCCAGGTGGGCCTCAGTGGG No data
1199679261_1199679272 6 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679272 X:150214319-150214341 GGTGGGCCTCAGTGGGAGGTAGG No data
1199679261_1199679268 -2 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679268 X:150214311-150214333 GGTCTCCAGGTGGGCCTCAGTGG No data
1199679261_1199679270 2 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679270 X:150214315-150214337 TCCAGGTGGGCCTCAGTGGGAGG No data
1199679261_1199679274 10 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679274 X:150214323-150214345 GGCCTCAGTGGGAGGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199679261 Original CRISPR CCAGTGAGGAGATGCCTGAA GGG (reversed) Intergenic