ID: 1199679262 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:150214290-150214312 |
Sequence | CCCTTCAGGCATCTCCTCAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1199679259_1199679262 | -2 | Left | 1199679259 | X:150214269-150214291 | CCAGATGTATATTGGGGATCACC | No data | ||
Right | 1199679262 | X:150214290-150214312 | CCCTTCAGGCATCTCCTCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1199679262 | Original CRISPR | CCCTTCAGGCATCTCCTCAC TGG | Intergenic | ||