ID: 1199679265

View in Genome Browser
Species Human (GRCh38)
Location X:150214301-150214323
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199679259_1199679265 9 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679265 X:150214301-150214323 TCTCCTCACTGGTCTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199679265 Original CRISPR TCTCCTCACTGGTCTCCAGG TGG Intergenic