ID: 1199679266

View in Genome Browser
Species Human (GRCh38)
Location X:150214302-150214324
Sequence CTCCTCACTGGTCTCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199679259_1199679266 10 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679266 X:150214302-150214324 CTCCTCACTGGTCTCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199679266 Original CRISPR CTCCTCACTGGTCTCCAGGT GGG Intergenic