ID: 1199679267

View in Genome Browser
Species Human (GRCh38)
Location X:150214304-150214326
Sequence GGCCCACCTGGAGACCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199679267_1199679277 29 Left 1199679267 X:150214304-150214326 CCTCACTGGTCTCCAGGTGGGCC No data
Right 1199679277 X:150214356-150214378 AGTCCAGGTATGACCACAGTTGG No data
1199679267_1199679273 -5 Left 1199679267 X:150214304-150214326 CCTCACTGGTCTCCAGGTGGGCC No data
Right 1199679273 X:150214322-150214344 GGGCCTCAGTGGGAGGTAGGAGG No data
1199679267_1199679272 -8 Left 1199679267 X:150214304-150214326 CCTCACTGGTCTCCAGGTGGGCC No data
Right 1199679272 X:150214319-150214341 GGTGGGCCTCAGTGGGAGGTAGG No data
1199679267_1199679276 14 Left 1199679267 X:150214304-150214326 CCTCACTGGTCTCCAGGTGGGCC No data
Right 1199679276 X:150214341-150214363 GAGGGCAAAGACTGAAGTCCAGG No data
1199679267_1199679274 -4 Left 1199679267 X:150214304-150214326 CCTCACTGGTCTCCAGGTGGGCC No data
Right 1199679274 X:150214323-150214345 GGCCTCAGTGGGAGGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199679267 Original CRISPR GGCCCACCTGGAGACCAGTG AGG (reversed) Intergenic