ID: 1199679268

View in Genome Browser
Species Human (GRCh38)
Location X:150214311-150214333
Sequence GGTCTCCAGGTGGGCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199679261_1199679268 -2 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679268 X:150214311-150214333 GGTCTCCAGGTGGGCCTCAGTGG No data
1199679263_1199679268 -3 Left 1199679263 X:150214291-150214313 CCTTCAGGCATCTCCTCACTGGT No data
Right 1199679268 X:150214311-150214333 GGTCTCCAGGTGGGCCTCAGTGG No data
1199679259_1199679268 19 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679268 X:150214311-150214333 GGTCTCCAGGTGGGCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199679268 Original CRISPR GGTCTCCAGGTGGGCCTCAG TGG Intergenic