ID: 1199679273

View in Genome Browser
Species Human (GRCh38)
Location X:150214322-150214344
Sequence GGGCCTCAGTGGGAGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199679261_1199679273 9 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679273 X:150214322-150214344 GGGCCTCAGTGGGAGGTAGGAGG No data
1199679267_1199679273 -5 Left 1199679267 X:150214304-150214326 CCTCACTGGTCTCCAGGTGGGCC No data
Right 1199679273 X:150214322-150214344 GGGCCTCAGTGGGAGGTAGGAGG No data
1199679263_1199679273 8 Left 1199679263 X:150214291-150214313 CCTTCAGGCATCTCCTCACTGGT No data
Right 1199679273 X:150214322-150214344 GGGCCTCAGTGGGAGGTAGGAGG No data
1199679259_1199679273 30 Left 1199679259 X:150214269-150214291 CCAGATGTATATTGGGGATCACC No data
Right 1199679273 X:150214322-150214344 GGGCCTCAGTGGGAGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199679273 Original CRISPR GGGCCTCAGTGGGAGGTAGG AGG Intergenic