ID: 1199679274

View in Genome Browser
Species Human (GRCh38)
Location X:150214323-150214345
Sequence GGCCTCAGTGGGAGGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199679263_1199679274 9 Left 1199679263 X:150214291-150214313 CCTTCAGGCATCTCCTCACTGGT No data
Right 1199679274 X:150214323-150214345 GGCCTCAGTGGGAGGTAGGAGGG No data
1199679267_1199679274 -4 Left 1199679267 X:150214304-150214326 CCTCACTGGTCTCCAGGTGGGCC No data
Right 1199679274 X:150214323-150214345 GGCCTCAGTGGGAGGTAGGAGGG No data
1199679261_1199679274 10 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679274 X:150214323-150214345 GGCCTCAGTGGGAGGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199679274 Original CRISPR GGCCTCAGTGGGAGGTAGGA GGG Intergenic