ID: 1199679276

View in Genome Browser
Species Human (GRCh38)
Location X:150214341-150214363
Sequence GAGGGCAAAGACTGAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199679267_1199679276 14 Left 1199679267 X:150214304-150214326 CCTCACTGGTCTCCAGGTGGGCC No data
Right 1199679276 X:150214341-150214363 GAGGGCAAAGACTGAAGTCCAGG No data
1199679263_1199679276 27 Left 1199679263 X:150214291-150214313 CCTTCAGGCATCTCCTCACTGGT No data
Right 1199679276 X:150214341-150214363 GAGGGCAAAGACTGAAGTCCAGG No data
1199679261_1199679276 28 Left 1199679261 X:150214290-150214312 CCCTTCAGGCATCTCCTCACTGG No data
Right 1199679276 X:150214341-150214363 GAGGGCAAAGACTGAAGTCCAGG No data
1199679275_1199679276 -7 Left 1199679275 X:150214325-150214347 CCTCAGTGGGAGGTAGGAGGGCA No data
Right 1199679276 X:150214341-150214363 GAGGGCAAAGACTGAAGTCCAGG No data
1199679271_1199679276 2 Left 1199679271 X:150214316-150214338 CCAGGTGGGCCTCAGTGGGAGGT No data
Right 1199679276 X:150214341-150214363 GAGGGCAAAGACTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199679276 Original CRISPR GAGGGCAAAGACTGAAGTCC AGG Intergenic