ID: 1199681116

View in Genome Browser
Species Human (GRCh38)
Location X:150225314-150225336
Sequence TGGGCTTCACAACCTCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199681116_1199681127 27 Left 1199681116 X:150225314-150225336 CCCTGATGAGGTTGTGAAGCCCA No data
Right 1199681127 X:150225364-150225386 CAACCTGCAAAGGGCCATGCAGG No data
1199681116_1199681126 18 Left 1199681116 X:150225314-150225336 CCCTGATGAGGTTGTGAAGCCCA No data
Right 1199681126 X:150225355-150225377 AGCATTTTACAACCTGCAAAGGG No data
1199681116_1199681125 17 Left 1199681116 X:150225314-150225336 CCCTGATGAGGTTGTGAAGCCCA No data
Right 1199681125 X:150225354-150225376 AAGCATTTTACAACCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199681116 Original CRISPR TGGGCTTCACAACCTCATCA GGG (reversed) Intergenic
No off target data available for this crispr