ID: 1199683760

View in Genome Browser
Species Human (GRCh38)
Location X:150245749-150245771
Sequence ATGTATGTACATTTGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199683755_1199683760 -6 Left 1199683755 X:150245732-150245754 CCAGGCTTGGCATATCTATGTAT No data
Right 1199683760 X:150245749-150245771 ATGTATGTACATTTGGGGTTGGG No data
1199683754_1199683760 4 Left 1199683754 X:150245722-150245744 CCAGAAATTTCCAGGCTTGGCAT No data
Right 1199683760 X:150245749-150245771 ATGTATGTACATTTGGGGTTGGG No data
1199683751_1199683760 20 Left 1199683751 X:150245706-150245728 CCATAGAAAATAAACTCCAGAAA No data
Right 1199683760 X:150245749-150245771 ATGTATGTACATTTGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199683760 Original CRISPR ATGTATGTACATTTGGGGTT GGG Intergenic
No off target data available for this crispr