ID: 1199685655

View in Genome Browser
Species Human (GRCh38)
Location X:150263053-150263075
Sequence CACGGCAACCAGGTGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199685655_1199685665 17 Left 1199685655 X:150263053-150263075 CCTGCCTCCACCTGGTTGCCGTG No data
Right 1199685665 X:150263093-150263115 TGAAGGGACATTCAGGTATTGGG No data
1199685655_1199685664 16 Left 1199685655 X:150263053-150263075 CCTGCCTCCACCTGGTTGCCGTG No data
Right 1199685664 X:150263092-150263114 TTGAAGGGACATTCAGGTATTGG No data
1199685655_1199685666 30 Left 1199685655 X:150263053-150263075 CCTGCCTCCACCTGGTTGCCGTG No data
Right 1199685666 X:150263106-150263128 AGGTATTGGGTATCAAGAGATGG No data
1199685655_1199685663 10 Left 1199685655 X:150263053-150263075 CCTGCCTCCACCTGGTTGCCGTG No data
Right 1199685663 X:150263086-150263108 GTATTCTTGAAGGGACATTCAGG No data
1199685655_1199685662 1 Left 1199685655 X:150263053-150263075 CCTGCCTCCACCTGGTTGCCGTG No data
Right 1199685662 X:150263077-150263099 CAGCAGCTGGTATTCTTGAAGGG No data
1199685655_1199685661 0 Left 1199685655 X:150263053-150263075 CCTGCCTCCACCTGGTTGCCGTG No data
Right 1199685661 X:150263076-150263098 ACAGCAGCTGGTATTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199685655 Original CRISPR CACGGCAACCAGGTGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr