ID: 1199688276

View in Genome Browser
Species Human (GRCh38)
Location X:150284114-150284136
Sequence TTCCATGTGAAGATACAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199688276_1199688277 18 Left 1199688276 X:150284114-150284136 CCTTGCTGTATCTTCACATGGAA No data
Right 1199688277 X:150284155-150284177 TCTGATATCTCTTCTTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199688276 Original CRISPR TTCCATGTGAAGATACAGCA AGG (reversed) Intergenic
No off target data available for this crispr