ID: 1199692336

View in Genome Browser
Species Human (GRCh38)
Location X:150318109-150318131
Sequence TTGAGCATTGCTGAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199692336_1199692339 8 Left 1199692336 X:150318109-150318131 CCCTCCATCTCAGCAATGCTCAA No data
Right 1199692339 X:150318140-150318162 AGTTCCATCATGCCTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199692336 Original CRISPR TTGAGCATTGCTGAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr