ID: 1199692340

View in Genome Browser
Species Human (GRCh38)
Location X:150318144-150318166
Sequence GCTTCCAAGCAGAGGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199692340_1199692344 11 Left 1199692340 X:150318144-150318166 CCATCATGCCTCTGCTTGGAAGC No data
Right 1199692344 X:150318178-150318200 TTGTCCCCCTGGAAGACTAGCGG No data
1199692340_1199692350 29 Left 1199692340 X:150318144-150318166 CCATCATGCCTCTGCTTGGAAGC No data
Right 1199692350 X:150318196-150318218 AGCGGCAGCCCCTGCGTGGTAGG No data
1199692340_1199692349 25 Left 1199692340 X:150318144-150318166 CCATCATGCCTCTGCTTGGAAGC No data
Right 1199692349 X:150318192-150318214 GACTAGCGGCAGCCCCTGCGTGG No data
1199692340_1199692343 0 Left 1199692340 X:150318144-150318166 CCATCATGCCTCTGCTTGGAAGC No data
Right 1199692343 X:150318167-150318189 CATTCTTCATCTTGTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199692340 Original CRISPR GCTTCCAAGCAGAGGCATGA TGG (reversed) Intergenic
No off target data available for this crispr