ID: 1199692344

View in Genome Browser
Species Human (GRCh38)
Location X:150318178-150318200
Sequence TTGTCCCCCTGGAAGACTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199692341_1199692344 3 Left 1199692341 X:150318152-150318174 CCTCTGCTTGGAAGCCATTCTTC No data
Right 1199692344 X:150318178-150318200 TTGTCCCCCTGGAAGACTAGCGG No data
1199692340_1199692344 11 Left 1199692340 X:150318144-150318166 CCATCATGCCTCTGCTTGGAAGC No data
Right 1199692344 X:150318178-150318200 TTGTCCCCCTGGAAGACTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199692344 Original CRISPR TTGTCCCCCTGGAAGACTAG CGG Intergenic
No off target data available for this crispr