ID: 1199692349

View in Genome Browser
Species Human (GRCh38)
Location X:150318192-150318214
Sequence GACTAGCGGCAGCCCCTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199692340_1199692349 25 Left 1199692340 X:150318144-150318166 CCATCATGCCTCTGCTTGGAAGC No data
Right 1199692349 X:150318192-150318214 GACTAGCGGCAGCCCCTGCGTGG No data
1199692341_1199692349 17 Left 1199692341 X:150318152-150318174 CCTCTGCTTGGAAGCCATTCTTC No data
Right 1199692349 X:150318192-150318214 GACTAGCGGCAGCCCCTGCGTGG No data
1199692342_1199692349 3 Left 1199692342 X:150318166-150318188 CCATTCTTCATCTTGTCCCCCTG No data
Right 1199692349 X:150318192-150318214 GACTAGCGGCAGCCCCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199692349 Original CRISPR GACTAGCGGCAGCCCCTGCG TGG Intergenic
No off target data available for this crispr