ID: 1199692350

View in Genome Browser
Species Human (GRCh38)
Location X:150318196-150318218
Sequence AGCGGCAGCCCCTGCGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199692346_1199692350 -10 Left 1199692346 X:150318183-150318205 CCCCTGGAAGACTAGCGGCAGCC No data
Right 1199692350 X:150318196-150318218 AGCGGCAGCCCCTGCGTGGTAGG No data
1199692345_1199692350 -9 Left 1199692345 X:150318182-150318204 CCCCCTGGAAGACTAGCGGCAGC No data
Right 1199692350 X:150318196-150318218 AGCGGCAGCCCCTGCGTGGTAGG No data
1199692341_1199692350 21 Left 1199692341 X:150318152-150318174 CCTCTGCTTGGAAGCCATTCTTC No data
Right 1199692350 X:150318196-150318218 AGCGGCAGCCCCTGCGTGGTAGG No data
1199692342_1199692350 7 Left 1199692342 X:150318166-150318188 CCATTCTTCATCTTGTCCCCCTG No data
Right 1199692350 X:150318196-150318218 AGCGGCAGCCCCTGCGTGGTAGG No data
1199692340_1199692350 29 Left 1199692340 X:150318144-150318166 CCATCATGCCTCTGCTTGGAAGC No data
Right 1199692350 X:150318196-150318218 AGCGGCAGCCCCTGCGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199692350 Original CRISPR AGCGGCAGCCCCTGCGTGGT AGG Intergenic
No off target data available for this crispr