ID: 1199699333

View in Genome Browser
Species Human (GRCh38)
Location X:150364436-150364458
Sequence CCCGAGGCGCGTGTTTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199699333_1199699345 24 Left 1199699333 X:150364436-150364458 CCTGTGCAAACACGCGCCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1199699345 X:150364483-150364505 CGCGCTTCTGCAGCTGGGTGCGG 0: 1
1: 0
2: 0
3: 23
4: 182
1199699333_1199699340 18 Left 1199699333 X:150364436-150364458 CCTGTGCAAACACGCGCCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1199699340 X:150364477-150364499 CCCCGCCGCGCTTCTGCAGCTGG 0: 1
1: 0
2: 2
3: 9
4: 159
1199699333_1199699342 19 Left 1199699333 X:150364436-150364458 CCTGTGCAAACACGCGCCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1199699342 X:150364478-150364500 CCCGCCGCGCTTCTGCAGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199699333 Original CRISPR CCCGAGGCGCGTGTTTGCAC AGG (reversed) Intronic
901209498 1:7516446-7516468 GCAGAGGGGCGTGTGTGCACTGG - Intronic
910492416 1:87787110-87787132 GCTGAGGCCCTTGTTTGCACAGG - Intergenic
922821307 1:228487527-228487549 CCCGGGGCGCGCGCTGGCACAGG - Exonic
1076841382 10:133047567-133047589 CCCGAGGGCCGGGTGTGCACTGG - Intergenic
1077412513 11:2410268-2410290 CCGGAGGCCTGTGTTTGCTCCGG + Intronic
1084053448 11:66616237-66616259 CCCCAGGCGCGGGTTTGGACAGG + Intergenic
1084741607 11:71143434-71143456 CCCGATGCGCGGGTTCCCACGGG + Intronic
1093164376 12:15788921-15788943 CCCTGGGCGCGGGTCTGCACGGG + Intronic
1104694765 12:130854854-130854876 TCCCAGGAGTGTGTTTGCACAGG + Intergenic
1107995084 13:45851383-45851405 CCCGAGACCCGGGTTTGCAAAGG + Intronic
1111641419 13:90975387-90975409 CCCGAGGCAAGAGTTTGCAGGGG - Intergenic
1143100416 17:4501501-4501523 GCCCAGGCAAGTGTTTGCACAGG - Intronic
1150003264 17:61455038-61455060 CCCGAGGCGGGTGCTGGCGCTGG + Intronic
1151479193 17:74360400-74360422 CACGAGGCGCGTGGATGCATCGG + Intronic
1153137335 18:1930704-1930726 CCCGGGGCCTGTGTTTGCAGTGG - Intergenic
1161678930 19:5669325-5669347 CCCGAGGCGTGCTTGTGCACAGG + Intergenic
1166026517 19:40090735-40090757 CCCCAGGCGTGTGTGTGCGCGGG - Intronic
926077089 2:9950894-9950916 CCCGGGGCGCGCGACTGCACGGG + Intergenic
1180033149 21:45225923-45225945 CCCGAGGCCAGTGGTTGCTCGGG + Exonic
1181953900 22:26574533-26574555 CCTGAGGCACCTGTTTGCCCAGG + Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
955232309 3:57109983-57110005 CCCGAGAGGCATGTTTACACAGG + Intronic
962393203 3:134991640-134991662 CCAGGGGAGAGTGTTTGCACTGG - Intronic
1001686724 5:173598971-173598993 CCCGAGGAAGATGTTTGCACAGG - Intergenic
1015618689 6:135106792-135106814 CCCGAGGCCCGTGTTTGCGATGG - Intergenic
1018687301 6:166313737-166313759 CCCGTGGTGCGTGATGGCACAGG - Intergenic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1190570839 X:51779637-51779659 CCAGAGCCTCCTGTTTGCACTGG - Intergenic
1198801397 X:140451606-140451628 CCCCAGGCTCGTGTTTGTATTGG + Intergenic
1199699333 X:150364436-150364458 CCCGAGGCGCGTGTTTGCACAGG - Intronic