ID: 1199702028

View in Genome Browser
Species Human (GRCh38)
Location X:150387347-150387369
Sequence ATTACTACGTAAAAACTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199702028_1199702032 14 Left 1199702028 X:150387347-150387369 CCAACCAGTTTTTACGTAGTAAT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1199702032 X:150387384-150387406 AAGCCAAAGAAATGGTGTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 296
1199702028_1199702031 13 Left 1199702028 X:150387347-150387369 CCAACCAGTTTTTACGTAGTAAT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1199702031 X:150387383-150387405 AAAGCCAAAGAAATGGTGTCTGG 0: 1
1: 0
2: 2
3: 30
4: 318
1199702028_1199702030 6 Left 1199702028 X:150387347-150387369 CCAACCAGTTTTTACGTAGTAAT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1199702030 X:150387376-150387398 CAGTAAGAAAGCCAAAGAAATGG 0: 1
1: 1
2: 3
3: 80
4: 863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199702028 Original CRISPR ATTACTACGTAAAAACTGGT TGG (reversed) Intronic
903726510 1:25450759-25450781 AATACAAATTAAAAACTGGTGGG - Intronic
911824479 1:102463895-102463917 GTTATTACGCTAAAACTGGTGGG + Intergenic
913590498 1:120320159-120320181 ATTTCAACATATAAACTGGTGGG - Intergenic
913617686 1:120578204-120578226 ATTTCAACATATAAACTGGTGGG + Intergenic
914572586 1:148932768-148932790 ATTTCAACATATAAACTGGTGGG - Intronic
914600254 1:149197494-149197516 ATTTCAACATATAAACTGGTGGG + Intergenic
919035089 1:192296298-192296320 ATTACTAAATAATAATTGGTGGG + Intergenic
919361455 1:196600925-196600947 AGTACAAAGTCAAAACTGGTTGG - Intronic
920125314 1:203689665-203689687 ACTAATACTTAAAAACTGCTAGG + Intronic
921089005 1:211825030-211825052 TTTGCTACGTAAAAACAGCTTGG + Intronic
923835047 1:237601843-237601865 ATTACTATGTGAACACTGCTTGG - Intronic
1070951755 10:80436781-80436803 CTTTCTGTGTAAAAACTGGTTGG + Exonic
1073023773 10:100470593-100470615 AATACTACGTAAAGATTTGTGGG + Intronic
1078623783 11:12934814-12934836 ATTACTACGTGACAAGTGCTGGG - Intronic
1080105254 11:28504999-28505021 ATTACAACTGAACAACTGGTAGG + Intergenic
1085647673 11:78237600-78237622 ATTTCTTCCTAAAAACTTGTGGG + Intronic
1086803490 11:91208391-91208413 ATTACTAATTAAACTCTGGTAGG + Intergenic
1089880863 11:121772048-121772070 ATTACTAAGTAAACCCTGCTGGG - Intergenic
1098314789 12:69181980-69182002 ATAAATAAATAAAAACTGGTGGG + Intergenic
1099726293 12:86432130-86432152 ATTACCTCTTAAATACTGGTGGG + Intronic
1106275378 13:28200554-28200576 ATTACTAAGTAATAAAGGGTAGG - Intronic
1109367987 13:61382529-61382551 TTGACTACGTAAATATTGGTTGG - Intergenic
1115322228 14:32094710-32094732 ATTAATACCGCAAAACTGGTAGG - Intronic
1116982110 14:51182714-51182736 ATTACTACCTGAAAGCTGGGAGG + Intergenic
1117450616 14:55846029-55846051 AATACTACGTAGAAAAGGGTGGG - Intergenic
1118095581 14:62533476-62533498 ATTATTATGAAAAAACTGGGTGG + Intergenic
1118232410 14:63965441-63965463 ATCACAACGTAAAAACAGCTGGG - Intronic
1122105592 14:99452003-99452025 TTTACAATGTAAAAACTGGAAGG + Intronic
1125706967 15:41746856-41746878 ATTAATAAATAAAAATTGGTAGG - Intronic
1126481471 15:49126501-49126523 ATTATTATGTAAAAACTGGGTGG - Intronic
1137631551 16:49949625-49949647 ACAACTAGGTAAAAGCTGGTAGG + Intergenic
1146382694 17:32342633-32342655 ATGACTACGTAAAAACTAAAAGG + Intronic
1160224745 18:77003900-77003922 TTTTCTACCTAAAAACCGGTGGG + Intronic
1167421275 19:49404882-49404904 ATTATTTCTTATAAACTGGTAGG - Intronic
927762238 2:25768902-25768924 ATTATTACTAAAAAACTGATTGG - Intronic
931326177 2:61226523-61226545 ATTACTAAGTAAAAAAAGGTGGG - Intronic
936412515 2:112273274-112273296 ATTATTAGGTAAAATCTGTTAGG + Intergenic
937367124 2:121271348-121271370 ATGACTACGAAAAATCTGGAAGG + Intronic
937942607 2:127297668-127297690 ATTCCTAGGTATAAATTGGTGGG + Intergenic
939864828 2:147461014-147461036 AGTCCTACGTAAAAGCTGGATGG + Intergenic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
945856887 2:215079902-215079924 ATTAATACCAAAATACTGGTTGG + Intronic
1175012027 20:55747579-55747601 ATTACTTAGCAAAAATTGGTTGG - Intergenic
949670770 3:6397571-6397593 ATTACTACTTAATAACTGTCAGG + Intergenic
952555675 3:34527450-34527472 ATTACAATGTAAGAACTGGGTGG + Intergenic
955783368 3:62509763-62509785 CTTCCTATGTAAAAAGTGGTAGG + Intronic
958590314 3:96149820-96149842 ATTACTTCATAAATACTGGCAGG + Intergenic
961081378 3:124032180-124032202 ATTATTGCTTAAAAACTGATGGG + Intergenic
966654591 3:182341282-182341304 ATTACTGGGTAAAAACTGAAAGG + Intergenic
970118481 4:12725973-12725995 CTTACTAGGAAAACACTGGTTGG + Intergenic
975606067 4:76155651-76155673 ATTACAACCTAAACACAGGTTGG - Intergenic
980181651 4:129408363-129408385 ATTACTACATAAAAAATTATGGG + Intergenic
981931389 4:150192661-150192683 ATTAATATATAAAAACTGCTTGG - Intronic
983193224 4:164776850-164776872 ATTATTAGGTAAAAAGTGGTAGG - Intergenic
984922896 4:184781465-184781487 ATAACTAAGTAAAAATTGATAGG + Intronic
989284073 5:39678787-39678809 CTTACTTCTTAAAAACTGGTAGG + Intergenic
993884596 5:93400942-93400964 ATTACTAGTTAAAAGCAGGTAGG + Intergenic
999959656 5:156740922-156740944 ATAACTTAGAAAAAACTGGTGGG - Intronic
1002635756 5:180607804-180607826 ATTACCAAGGAATAACTGGTGGG + Intronic
1008037440 6:46760807-46760829 CTTACTACCTAAAAACTTGTGGG - Intergenic
1011612269 6:89164426-89164448 ATTATTATGTAAAAACTGGGTGG + Exonic
1012179262 6:96130618-96130640 AATAATATGTAAAAACAGGTTGG - Intronic
1013113992 6:107086728-107086750 GTTACTAAGAAAAAACTGGCTGG + Intronic
1014239538 6:118999875-118999897 ATTACTCAGTACAAACTGCTTGG + Intronic
1014812471 6:125902187-125902209 AATACTAGGTAAAAAAGGGTGGG - Intronic
1021136866 7:16975752-16975774 CTTACTCCATAAAAGCTGGTTGG - Intergenic
1027640364 7:80725700-80725722 ATTACTAAGCAAAGATTGGTGGG + Intergenic
1027877188 7:83786114-83786136 ATTACTACATATAAACTCATGGG + Intergenic
1027914114 7:84292591-84292613 AATACTACGTAAAAATCTGTAGG + Intronic
1031430084 7:121657337-121657359 ATTGCTAAATATAAACTGGTAGG + Intergenic
1034607209 7:152328146-152328168 GTTACTATGTAAAATATGGTGGG + Intronic
1038029578 8:23625596-23625618 ATTACAACTTTAAAACTGGAAGG - Intergenic
1039130315 8:34256866-34256888 ACTACTACGTACAAAATAGTTGG - Intergenic
1039333108 8:36560782-36560804 ATTCCTAAGAAAAAACAGGTAGG + Intergenic
1040700742 8:50061556-50061578 ATTCCTACCTAAAAAGTAGTGGG - Intronic
1040873797 8:52128939-52128961 ATTACTAGGTAACAAGTGATGGG + Intronic
1041450057 8:57996003-57996025 ATCACTACGTGTAAACTGGGGGG - Intronic
1046212026 8:111088851-111088873 ATTAATACTTGAAAACTTGTTGG + Intergenic
1048153500 8:131917749-131917771 AATGCTACAGAAAAACTGGTTGG + Intronic
1057465093 9:95306357-95306379 ATTACCAAGCAGAAACTGGTTGG + Intronic
1060471421 9:123951625-123951647 ATTGCTACCCAAAATCTGGTGGG + Intergenic
1189248328 X:39580679-39580701 CTTACTAAGTGTAAACTGGTAGG - Intergenic
1194709949 X:97223432-97223454 TTTTCTACCCAAAAACTGGTGGG - Intronic
1198039143 X:132832136-132832158 ATTAGTACTTAAGTACTGGTTGG - Intronic
1199210989 X:145210058-145210080 ATTACTACATGAAAACTTGGAGG + Intergenic
1199374715 X:147094142-147094164 ATTTCTTCCTAAAAACTGGAAGG - Intergenic
1199702028 X:150387347-150387369 ATTACTACGTAAAAACTGGTTGG - Intronic