ID: 1199704421

View in Genome Browser
Species Human (GRCh38)
Location X:150411517-150411539
Sequence GGCTGAACTGGACTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199704421_1199704427 16 Left 1199704421 X:150411517-150411539 CCAGCAGCAAGTCCAGTTCAGCC 0: 1
1: 1
2: 0
3: 11
4: 143
Right 1199704427 X:150411556-150411578 CCTCTTGGCCTCCAACCACCTGG 0: 1
1: 0
2: 1
3: 22
4: 220
1199704421_1199704425 1 Left 1199704421 X:150411517-150411539 CCAGCAGCAAGTCCAGTTCAGCC 0: 1
1: 1
2: 0
3: 11
4: 143
Right 1199704425 X:150411541-150411563 TTGGTATGCACAATGCCTCTTGG 0: 1
1: 0
2: 1
3: 4
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199704421 Original CRISPR GGCTGAACTGGACTTGCTGC TGG (reversed) Intronic
900514978 1:3077350-3077372 CGCTGGCCTGGGCTTGCTGCTGG + Intronic
902511633 1:16969877-16969899 GGCTGACCTGGAACTGCAGCGGG + Exonic
908182632 1:61621476-61621498 GGCCTCACTGGACTTGCTGGGGG - Intergenic
915018591 1:152759597-152759619 GGCGGCACTGGATCTGCTGCTGG - Exonic
915143540 1:153781079-153781101 GGCTGCACCGGGCTTGCTGGTGG - Intergenic
916028478 1:160855884-160855906 GGCTGAGCGGGACTCACTGCTGG - Intronic
917058222 1:171007270-171007292 GGGTGAACTGGCCTAGCTCCAGG + Intronic
917697786 1:177545356-177545378 GGCTGGACTGAACTTGCTCAAGG + Intergenic
920873813 1:209816175-209816197 GCCTGAACTAGAAATGCTGCCGG - Intergenic
921995421 1:221412945-221412967 GGCTGAACTGAACTTTGTGTTGG - Intergenic
922554475 1:226522225-226522247 GGCTGAGCTGGGCTGGGTGCAGG - Intergenic
923018612 1:230145985-230146007 GGCTGTAGTGGACCTGCTTCTGG + Intronic
1064823361 10:19365361-19365383 AGTTGAACTGGACATACTGCAGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1070792265 10:79196522-79196544 GGCTGGACTGAACTGGCTTCTGG - Intronic
1071105993 10:82095624-82095646 AGCTGACCTGAACTAGCTGCTGG + Intronic
1071965212 10:90845031-90845053 GGCTGAAGTTGAGTTGCTGGGGG + Intronic
1075647450 10:124105765-124105787 GGCTGAACAGGACCTGCCCCAGG + Intergenic
1076236604 10:128868423-128868445 GTCAGAACAGGACTTGCTGTTGG + Intergenic
1076393584 10:130121837-130121859 TGCTCACCTGGACTTGCTGAGGG + Intergenic
1076469066 10:130705956-130705978 GGCACAACTGGAGCTGCTGCAGG + Intergenic
1076667617 10:132102143-132102165 GGCTCGGCTGGCCTTGCTGCTGG - Intergenic
1077015471 11:397251-397273 GGCTGCTCTGGAATCGCTGCAGG - Exonic
1077405013 11:2378914-2378936 GGCTGAACTGAACTCTCAGCTGG + Intronic
1084175145 11:67419000-67419022 GGCTGAGCTGGCCCGGCTGCTGG + Exonic
1084530266 11:69723169-69723191 GGGTGAACTGCACTGGGTGCAGG + Intergenic
1084714037 11:70862472-70862494 GCCTGGACTGGACTGGCTGATGG + Intronic
1084714062 11:70862622-70862644 GACTGGACTGGACTGGCTGATGG + Intronic
1087840043 11:102910956-102910978 GGCTGAGCAGGAATTGATGCAGG - Intergenic
1088286909 11:108199287-108199309 GGCACAACTGGACCAGCTGCGGG + Intronic
1091402442 12:189165-189187 GGAAGTACTGGACTAGCTGCGGG + Intergenic
1094480817 12:30880134-30880156 GGCAGCACAGAACTTGCTGCAGG - Intergenic
1096499696 12:52057194-52057216 GGCTGACCAGGACCTGTTGCTGG + Exonic
1103428669 12:120862415-120862437 GGGTGACCTGGACTTGATACCGG - Intronic
1103446359 12:120997538-120997560 GGGAGAACTGGACGGGCTGCAGG - Exonic
1111911021 13:94311993-94312015 AACTGAACTGGACCAGCTGCAGG - Intronic
1113928479 13:113953876-113953898 GGCTGTCCTGGACAGGCTGCCGG - Intergenic
1114267499 14:21081577-21081599 GGCTGCACTGGCCCTGCGGCGGG + Exonic
1115935527 14:38548067-38548089 GGCTAACCTGGAGTTGCTACTGG + Intergenic
1116330499 14:43591811-43591833 GGCACAACTGGAAGTGCTGCAGG + Intergenic
1117640910 14:57798769-57798791 GGCTGAGCAGGACGTGCCGCTGG - Intronic
1119705029 14:76778018-76778040 GGCTGGACTGGGCCCGCTGCGGG - Exonic
1121412372 14:93756858-93756880 GTTTGAAGGGGACTTGCTGCTGG - Intronic
1121470384 14:94148998-94149020 GGATGAAGTGGACTTGATCCTGG + Intronic
1124330895 15:28814029-28814051 ATGGGAACTGGACTTGCTGCTGG + Intergenic
1127028032 15:54829762-54829784 GTCTTAACTGGACTTGCTGTTGG + Intergenic
1127174118 15:56336031-56336053 TACTGAACTGGACTTTATGCAGG - Intronic
1128600893 15:68994590-68994612 ACCTGAACTGGAGTTGCTCCCGG + Intronic
1129275499 15:74442723-74442745 GCCTCAACTGGAGCTGCTGCAGG - Intergenic
1129523874 15:76202001-76202023 GGCTGGACTGCACTGGGTGCTGG - Intronic
1129690857 15:77712553-77712575 GGCAGTGCTGGAATTGCTGCAGG - Intronic
1132470180 16:98144-98166 TGCGGACCTGGCCTTGCTGCAGG - Exonic
1134103870 16:11471525-11471547 GGCTGTGCTGGTCTTGCTGTAGG - Intronic
1137547634 16:49415508-49415530 GGATGCACTGGACATTCTGCAGG + Intergenic
1138661154 16:58517952-58517974 GGCTGAACTACACCTGCTGAAGG + Intronic
1140921404 16:79542166-79542188 AGCTGCACAGGACTTGCTCCAGG - Intergenic
1141569930 16:84928287-84928309 GGATGAACTGGCATTCCTGCTGG + Intergenic
1141763273 16:86043065-86043087 GGCTGCCCTGTACCTGCTGCGGG + Intergenic
1142276799 16:89123092-89123114 GGCTGAACTGGAAATGTTCCCGG - Intronic
1144794133 17:17879626-17879648 ATCTGATCTGGAGTTGCTGCAGG - Exonic
1147038736 17:37701091-37701113 GGGAGAACTGGACGGGCTGCAGG + Exonic
1150262983 17:63811786-63811808 AGCTGCACTTGACTTGCTGAAGG + Intronic
1151606071 17:75136885-75136907 GGCTGCACAGGACTTGCAGTGGG - Intronic
1151743837 17:76001159-76001181 GGCTGAACTGGGCTGGGTGAAGG + Intronic
1154371113 18:13764036-13764058 GGCTAAACTAGATTTGCTACAGG - Exonic
1155886665 18:31217051-31217073 GGGTGAACAGGAATTGCTGCAGG + Intergenic
1160805857 19:991884-991906 GGCGGAACTTGGCTTGCTGTGGG + Intronic
1160972707 19:1776463-1776485 GTCTGAACTGGGCTTGCAGGGGG + Exonic
1162476625 19:10904346-10904368 GGCTGGAGTGGAGTGGCTGCAGG + Intronic
1166803632 19:45472448-45472470 GGCTCCCTTGGACTTGCTGCTGG - Intronic
1167427166 19:49435271-49435293 AGCTGAACTGGGCTTTCTGCGGG + Exonic
1168326432 19:55541010-55541032 GGCTGTCCTGGACTTCCTGGGGG - Exonic
1168651744 19:58096548-58096570 GGATGAAGGGGATTTGCTGCAGG - Intronic
926238880 2:11069786-11069808 GTGTGAACTGGACTTGCGTCAGG - Intergenic
928313533 2:30229989-30230011 GGCTAAACGGGAGATGCTGCAGG - Intergenic
928385232 2:30862005-30862027 AGTTGAACTGGACGTGCTGGTGG - Intergenic
936993220 2:118387511-118387533 GGCAGGGCTGGACTTCCTGCTGG + Intergenic
941937804 2:170999990-171000012 GGCTCAAGTGGTCTTCCTGCTGG + Intronic
943068504 2:183114155-183114177 GGCTGAAGTGGGATTGCTACAGG - Intergenic
946340105 2:219061010-219061032 GGCTGTGCTGCCCTTGCTGCAGG - Intergenic
949010002 2:241672950-241672972 GGCTGTCCTGGAGCTGCTGCTGG + Exonic
1171937083 20:31285407-31285429 GCCTAAGCTGGACCTGCTGCTGG - Intergenic
1172620204 20:36313584-36313606 GGCTGGACTTGGCCTGCTGCTGG + Intronic
1172801416 20:37578980-37579002 GGCTGAGCTGGCCTGGCTGCTGG - Intergenic
1175364742 20:58445027-58445049 GGGTGAACTGGTATTGCTGCTGG + Exonic
1179716318 21:43290552-43290574 AGCTGGCCTGGGCTTGCTGCTGG - Intergenic
1179826201 21:43967941-43967963 CGCAGAACTGGTCATGCTGCTGG + Exonic
1182107726 22:27701179-27701201 AGCTGACCTGGTCTTGCTGCTGG - Intergenic
1182619955 22:31613515-31613537 GGCCTACCTGGACCTGCTGCTGG - Exonic
1182731512 22:32499045-32499067 GGTTGAACTGGACTTGGGGTGGG + Intergenic
1183606149 22:38867681-38867703 GGCTCAGCAGGACTTGGTGCGGG - Intronic
953929513 3:46998964-46998986 GGGTGCGCTGGACCTGCTGCTGG + Exonic
954602769 3:51883491-51883513 GTCTGAAATGCACGTGCTGCTGG - Intergenic
955616361 3:60811695-60811717 GGCTTCACTGTACTTGCTTCTGG - Intronic
956506776 3:69949115-69949137 GGCTGGACAGGAGTTGCTGATGG - Exonic
957078668 3:75619778-75619800 GGCTAAGCTGGCGTTGCTGCTGG - Intergenic
957313104 3:78544490-78544512 GGCAGAAGGGGACTTGCTCCCGG - Intergenic
962422552 3:135241191-135241213 GGCTGAAGTGAACTTGCGGTAGG - Exonic
963941492 3:151100076-151100098 GGCTGAACTGGCCCTGAGGCAGG + Intronic
967867251 3:194200419-194200441 GGCTGACATGGACTTTCTGAAGG - Intergenic
968681404 4:1923046-1923068 GTCTGCACTGGACGTGGTGCTGG + Intronic
969929163 4:10613421-10613443 GGCTGAACTGGAATGCCTGCAGG + Intronic
975194560 4:71508879-71508901 GGATAAGCTGGACGTGCTGCTGG - Intronic
976981183 4:91231859-91231881 TACTGAACTGGACTTTATGCAGG + Intronic
977614911 4:99077396-99077418 GGCTGAAGTGAACCTCCTGCAGG - Intronic
982193864 4:152888823-152888845 GGCTGAACTGGACCAGCTGTAGG + Intronic
984866440 4:184284262-184284284 GGCTGATCTGGCCAAGCTGCTGG - Intergenic
985636439 5:1038051-1038073 GGCTTTCCCGGACTTGCTGCTGG - Exonic
987010553 5:13758878-13758900 GGCGGAACTTGACGTGGTGCAGG - Exonic
989518703 5:42375381-42375403 CCATGCACTGGACTTGCTGCAGG + Intergenic
996493762 5:124129625-124129647 CCCTGAACTTGACTTGCTGCAGG + Intergenic
998127899 5:139636530-139636552 GGCAGAACTAGTTTTGCTGCTGG + Intergenic
1010793674 6:80094046-80094068 GGCTGAAATGGAATTGCTATTGG + Intergenic
1014360868 6:120471905-120471927 GGGTGGACTGGTCATGCTGCGGG - Intergenic
1015052450 6:128858306-128858328 AACTGAACTGGAATTGCTGGAGG + Intergenic
1019481576 7:1269499-1269521 GTCTGAGCTGAACTTGCGGCAGG - Intergenic
1022330462 7:29374262-29374284 TTCTGAACTGGACTTGCTTTGGG + Intronic
1022599961 7:31748707-31748729 GCCTCAACTGGCCTTGCTGACGG + Intergenic
1023801442 7:43838604-43838626 GGCTGAACTGGATTTGGGTCAGG - Intergenic
1023818579 7:43968141-43968163 GGCTGACTTGGAATTGCAGCAGG + Intergenic
1024060782 7:45696962-45696984 GGCTGAAGAGGACTTCCTGGAGG + Intronic
1025824015 7:64996333-64996355 ACCTGAACTGGAGTTGCTCCTGG + Intronic
1027956654 7:84887425-84887447 GGCTGAACTGTTCTCCCTGCAGG - Intergenic
1029743628 7:102505106-102505128 GGCTGACTTGGAATTGCAGCAGG + Intronic
1029761614 7:102604269-102604291 GGCTGACTTGGAATTGCAGCAGG + Intronic
1030110496 7:106022587-106022609 GGCTGGACTGGAGTAGCTGCAGG + Intronic
1031610959 7:123826848-123826870 GACTGAAAAGGACTTGCTGATGG + Intergenic
1035923293 8:3701419-3701441 GGCTGAACCGAAGCTGCTGCTGG + Intronic
1036574357 8:10011933-10011955 GAATCAACTGGACTTACTGCTGG + Intergenic
1036619470 8:10415181-10415203 GGCTGGACAGGGCTGGCTGCAGG - Intronic
1037982662 8:23265600-23265622 GGCTGCACAGCACTTCCTGCAGG + Intergenic
1039260570 8:35766895-35766917 GGGAGAACGGGACTTCCTGCAGG - Exonic
1041092430 8:54315646-54315668 GGCTGAGCTGGGCTCGGTGCCGG + Intergenic
1045048328 8:98300461-98300483 GGGTGAACAGGGCTTGCAGCAGG + Intergenic
1047129201 8:121999771-121999793 GGGTGGACTGGACTTTCTTCTGG + Intergenic
1047423241 8:124724503-124724525 AGCTGAACTGGGCCTGCTGCGGG - Intronic
1049560270 8:143306845-143306867 GGAGGAGCTGGACCTGCTGCCGG + Intronic
1049777773 8:144414349-144414371 TGCTGACCTGCACTGGCTGCAGG - Exonic
1051281313 9:15444049-15444071 GGCTGAACTGGTTTAGATGCAGG - Intronic
1051502315 9:17791302-17791324 GTCTGACCGTGACTTGCTGCAGG - Exonic
1051509665 9:17863494-17863516 GGATCAGCTGGAGTTGCTGCTGG + Intergenic
1051882907 9:21858408-21858430 GGCTGTACGGGACGTGATGCTGG + Intronic
1054925189 9:70581791-70581813 GCCTCAACTGGTCCTGCTGCTGG + Intronic
1056126996 9:83544078-83544100 GGCTCACCTGTTCTTGCTGCAGG - Intergenic
1056644642 9:88400184-88400206 GGCTGGACTGTAGTTGCAGCAGG + Intronic
1056936620 9:90919633-90919655 GGCTGAAATGGTCTTGGGGCAGG - Intergenic
1057150599 9:92792871-92792893 TGCTGAAGTGGTATTGCTGCTGG + Intergenic
1061644637 9:131990768-131990790 GGCTGAACTGCACCTCCTGGAGG + Intronic
1193257131 X:79362661-79362683 TGCTTACCTGGACTTGTTGCTGG - Exonic
1195902686 X:109815321-109815343 GACTGAACTGGACTTGCTGCTGG - Intergenic
1197061574 X:122187490-122187512 AGCTGTACTGTCCTTGCTGCAGG - Intergenic
1199704421 X:150411517-150411539 GGCTGAACTGGACTTGCTGCTGG - Intronic
1202168350 Y:22015757-22015779 ACCTGAACTGGAGTTGCTCCTGG - Intergenic
1202223011 Y:22570611-22570633 ACCTGAACTGGAGTTGCTCCTGG + Intergenic
1202320104 Y:23625049-23625071 ACCTGAACTGGAGTTGCTCCTGG - Intergenic
1202550663 Y:26045007-26045029 ACCTGAACTGGAGTTGCTCCTGG + Intergenic