ID: 1199704886

View in Genome Browser
Species Human (GRCh38)
Location X:150415509-150415531
Sequence TTGCATAAGCAAAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 418}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199704884_1199704886 5 Left 1199704884 X:150415481-150415503 CCTTTTCTACAATTCTCTCATAC 0: 1
1: 0
2: 1
3: 21
4: 326
Right 1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG 0: 1
1: 1
2: 3
3: 31
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199704886 Original CRISPR TTGCATAAGCAAAAAGAGGA AGG Intronic
900002999 1:25264-25286 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
900022719 1:195789-195811 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
902533344 1:17104727-17104749 TTGAAAAGGCAAAAAGAGGCCGG - Intronic
903298065 1:22358459-22358481 GAGCTTAAGCAAAAAGGGGAAGG - Intergenic
905023224 1:34832274-34832296 TCTCATTAGGAAAAAGAGGAAGG - Intronic
905949321 1:41934577-41934599 TTGCAACAGCAAACAGAAGAAGG + Intronic
906475184 1:46164774-46164796 TAGCATAAGCAAAACCAGGTAGG - Intronic
906615747 1:47231924-47231946 TTGCGTAAGGAAAAGGGGGAAGG + Intronic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
908288067 1:62630886-62630908 TTATATAAGAAAAAAGAGGCCGG + Intronic
908926660 1:69263973-69263995 TTACAGAAGCAAAGAGATGATGG + Intergenic
909364130 1:74799519-74799541 TTGCATAACTAAAAAGAGCCAGG - Intergenic
909381980 1:75009227-75009249 TACCATAAATAAAAAGAGGAGGG - Intergenic
909509969 1:76441397-76441419 TTGCTTAAGCTAGCAGAGGAAGG + Intronic
909782453 1:79563413-79563435 TATCTTAAGCAAAAAGAGGAAGG + Intergenic
910252932 1:85217219-85217241 TTCCAGAAGGAAAAAGAGTATGG + Intergenic
910354539 1:86340544-86340566 TTGAATGAGGAAAAAGAGGTAGG - Intergenic
911042460 1:93601743-93601765 TTGAATAAAGAAAAAGAAGAAGG + Intronic
912012247 1:104981953-104981975 TTGCATAATCAATGGGAGGAAGG + Intergenic
912185991 1:107276411-107276433 TGGCATAAGCAAAGGCAGGAGGG - Intronic
912481756 1:109986987-109987009 TTGCATTAGCTAAAAGAAGCAGG + Intronic
912919490 1:113852402-113852424 TTGCATAAAATAAAAGAGGTTGG + Intronic
913424269 1:118709331-118709353 ATGCCAGAGCAAAAAGAGGAAGG + Intergenic
913483653 1:119314257-119314279 CAGCATAAGCAAAAACATGAAGG + Intergenic
916044515 1:160989380-160989402 TTGCAGAAACAAACACAGGAAGG - Intergenic
916456273 1:164973922-164973944 TTGCATTAGGAGAAAGAGCATGG + Intergenic
917462638 1:175245619-175245641 TTGCAGAAGCAAAGAGATCAGGG - Intergenic
917661325 1:177180189-177180211 TTGCATATGGAAACTGAGGAAGG + Intronic
918625944 1:186656128-186656150 TCACATAAGCATAAAGAGGAGGG - Intergenic
918915180 1:190626423-190626445 TTACAAAAGGAAACAGAGGAAGG - Intergenic
919037843 1:192338951-192338973 TTGCATAACTAGAAAGGGGAAGG - Intronic
919178457 1:194050384-194050406 TTTCAGAAGAAAAAAGAGAAGGG + Intergenic
919357260 1:196538986-196539008 TAACATAACAAAAAAGAGGAGGG - Intronic
919465427 1:197918356-197918378 GGGCATAAGCAATAGGAGGACGG + Intronic
920224609 1:204429464-204429486 TTGCATATGGACAAATAGGAAGG + Intronic
920646729 1:207809192-207809214 TTGCATATAAAAAAAGAGAAAGG - Intergenic
921781141 1:219165988-219166010 TTGAAGAAGTAAATAGAGGAGGG + Intergenic
922029827 1:221787209-221787231 TTGGAAAAGAAAAAAGAGAATGG + Intergenic
922084026 1:222328242-222328264 TTACAGAAGCCAAAGGAGGAGGG - Intergenic
922170457 1:223150192-223150214 TTGCTTTGGCAAAAAGAGAAAGG - Intergenic
922327278 1:224539696-224539718 TAGCATAAGCAAAAACATGGAGG - Intronic
922521862 1:226260128-226260150 TTGCACAAGAAAAAAATGGAAGG + Intronic
922929813 1:229380330-229380352 TTGCAGAAGGAAAGAGGGGAGGG + Intergenic
922985399 1:229862406-229862428 TTGGTTAAAAAAAAAGAGGAGGG - Intergenic
923426030 1:233870621-233870643 TTCCATGAAAAAAAAGAGGAGGG + Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923919102 1:238544374-238544396 TTGCATAAACAAGAAGAAAATGG + Intergenic
924550186 1:245068879-245068901 TTGCACAAGAAAAAAAAGGAAGG + Intronic
1063398865 10:5721606-5721628 GTGAATAAGCAAATAGAGAAGGG + Intronic
1063865456 10:10360443-10360465 ATGCATGTGAAAAAAGAGGAAGG + Intergenic
1064149482 10:12850537-12850559 TTGAATAAGCCAGATGAGGAAGG - Intergenic
1065395533 10:25232805-25232827 ATGAATAAGCTAAAAGAAGAGGG - Intronic
1065505240 10:26423907-26423929 TTGCTTATGCCAAAAAAGGAAGG - Intergenic
1066203993 10:33169670-33169692 GTGCAGAAGGAAAAAGGGGAAGG + Intergenic
1066501484 10:35999365-35999387 TTGCAGAAAAAAAAAGAAGACGG - Intergenic
1067088207 10:43253869-43253891 TTGCAGCAGCAATAAGAGGCAGG + Intronic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069754788 10:70767237-70767259 TTATTTAAGCAAAAAGAGAAAGG + Intergenic
1070595727 10:77831668-77831690 GTGCATAAGTTAACAGAGGAAGG + Intronic
1071947951 10:90669157-90669179 TTGTGGAAACAAAAAGAGGAGGG + Intergenic
1072140154 10:92582505-92582527 TTGCAAAATAAAAAAGAGGAGGG - Intergenic
1072258274 10:93641773-93641795 TGGCAGAAGCAAAAAGACCAGGG - Intronic
1073369190 10:102971195-102971217 TTGCAGAAAAAAAAAAAGGATGG - Intronic
1074173743 10:110974576-110974598 ATCCATAAGAAAAGAGAGGAAGG - Intronic
1075179847 10:120200723-120200745 TTCCATAACCTCAAAGAGGAGGG - Intergenic
1076280894 10:129244772-129244794 TTGCATAAGCACAAAGCGTGTGG - Intergenic
1076584825 10:131539321-131539343 ATGCATAAGCAAAGAGATGAAGG - Intergenic
1077520352 11:3029687-3029709 GTGCAGAGGCAAAAAGAGGTGGG + Intronic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1077876384 11:6311528-6311550 TTGCTTAAACAATAGGAGGAGGG + Intergenic
1078161532 11:8843818-8843840 TTGGCTTAGCAAACAGAGGAGGG - Intronic
1078377992 11:10812276-10812298 ATTCATAAGCACAGAGAGGATGG - Intronic
1079213873 11:18488750-18488772 TTCAAAAAGCAAAAAAAGGAAGG + Intronic
1079765988 11:24393907-24393929 TTACATCAGCAAAGAGAGAAAGG + Intergenic
1079802611 11:24889103-24889125 TTACAGAAGCCAAAAGGGGATGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081173818 11:39901488-39901510 GGGCATATGAAAAAAGAGGAAGG - Intergenic
1081548979 11:44095112-44095134 ATGCATATGCAAAAACAAGAGGG - Intergenic
1082151355 11:48744005-48744027 TTGCAGATGCTACAAGAGGAAGG + Intergenic
1082631085 11:55543072-55543094 TTGTGTAAGCAATAAGAGCATGG - Intergenic
1083012532 11:59416966-59416988 TTTCTTATGCAAAAAGAGGCTGG - Intergenic
1086197785 11:84161687-84161709 TTGGATAAGGAAAAAGGAGAAGG + Intronic
1086700347 11:89894714-89894736 TTTCAGAAGAAAAAAGGGGAGGG - Intergenic
1086705823 11:89949812-89949834 TTTCAGAAGAAAAAAGGGGAGGG + Intergenic
1087866700 11:103237769-103237791 TTCCATAAGAAACAAGGGGAGGG + Intronic
1088367784 11:109057214-109057236 TTGCAAAGGCAAACATAGGAAGG - Intergenic
1088611272 11:111579648-111579670 TTGCAAGAGGAAAAAGGGGATGG - Intergenic
1088731205 11:112684600-112684622 TTTGATTAGCAAAAGGAGGAAGG + Intergenic
1089038128 11:115418079-115418101 GTGCAAAAGGTAAAAGAGGAAGG - Intronic
1090788315 11:130069438-130069460 TTCCAGAATCAAAAAGAGGGCGG + Intergenic
1090823671 11:130367748-130367770 TTGCATAAACAAAATCTGGAAGG + Intergenic
1091077515 11:132634049-132634071 TAGCAGAAGCAAAAAGGGAAAGG + Intronic
1091376417 12:27327-27349 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092191944 12:6527684-6527706 TTGCATGAACAAAGTGAGGAAGG - Intronic
1092600921 12:10063444-10063466 TTGGTTAATTAAAAAGAGGAGGG + Intronic
1093316802 12:17662451-17662473 ATGCATATCCAAAAATAGGAAGG - Intergenic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1094236921 12:28178452-28178474 TTGCTTCTGCAAAAATAGGATGG + Intronic
1095575356 12:43731604-43731626 TTGTTTAATAAAAAAGAGGAGGG + Intronic
1095744840 12:45646392-45646414 TGGTATAAACAATAAGAGGATGG + Intergenic
1096098426 12:48953517-48953539 GTGCATAAGCTAATAAAGGAAGG + Intronic
1096944198 12:55386026-55386048 TCTCAAAAACAAAAAGAGGAAGG - Intergenic
1098096109 12:66957956-66957978 TTGAATAAGCAAATAAATGAGGG - Intergenic
1098240901 12:68465999-68466021 TAGCTTAAGCAAAAAGAAAAGGG + Intergenic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1098572498 12:72004714-72004736 TAGCAAAAGCAGAAAGAAGATGG + Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1099316819 12:81094302-81094324 TTTCATAAGGAAAAAGATGGTGG - Intronic
1099430929 12:82584551-82584573 TTCCATAAGCAAGAAGAATATGG + Intergenic
1099589337 12:84567547-84567569 CTGCATAATCAAATAGATGAGGG - Intergenic
1099633387 12:85179095-85179117 TGGTATAAATAAAAAGAGGAAGG - Intronic
1101168079 12:102060241-102060263 TTTAAAAAGCCAAAAGAGGATGG - Intronic
1101604469 12:106237552-106237574 TTGAATAGGCATAAAGAGGCTGG - Intergenic
1101829014 12:108242787-108242809 TTGAATAAGGAAAAAGAGTGGGG - Intronic
1101938427 12:109079683-109079705 TTGCATAGGCAAACAGAGATTGG - Intronic
1102360431 12:112282511-112282533 TTGCATAAACAAACACTGGAAGG + Intronic
1104023363 12:125008612-125008634 CTGCATTAGAAAGAAGAGGAGGG - Intronic
1104465568 12:128987581-128987603 CTGCAGAGGCCAAAAGAGGAAGG - Intergenic
1104481305 12:129110622-129110644 GTGCATAAGTAAGGAGAGGAGGG + Intronic
1105435594 13:20375440-20375462 TTGAATAAACTAAAAGAAGATGG + Intergenic
1106950738 13:34880916-34880938 TTGCATCACCAAGAAGAGAAGGG - Intergenic
1107875160 13:44783787-44783809 TTGCAGTAACCAAAAGAGGAAGG + Intergenic
1109280932 13:60354500-60354522 TTGGATAATCAAAAAGGAGAAGG + Intergenic
1109435061 13:62287942-62287964 TTGCATAAGAAAAGAGAAGGTGG - Intergenic
1110904419 13:80867540-80867562 TTGAATCAGCAAATAAAGGATGG + Intergenic
1111171433 13:84531646-84531668 TTGATTAAGAAAAAAGAAGAGGG + Intergenic
1111449168 13:88391340-88391362 TTGCTTTAGCAAAAGGAGGAAGG + Intergenic
1111971840 13:94925010-94925032 TTGCAGAGGAAAAAAGAGGGGGG - Intergenic
1112136352 13:96582777-96582799 ATGCATATGTAAATAGAGGATGG - Intronic
1112341514 13:98556466-98556488 TAGTTTAAGCAAAAAGAAGAAGG - Intronic
1113374300 13:109750028-109750050 TAGCATGGTCAAAAAGAGGATGG - Intergenic
1113393450 13:109920043-109920065 TTGCATCAGCAGAAAGAAAATGG + Intergenic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115368765 14:32588356-32588378 TTGCAAAAGCATAAATAAGAAGG - Intronic
1115919702 14:38359034-38359056 TAGACTAAGCAAAAAAAGGATGG + Intergenic
1116922296 14:50592289-50592311 TGGCAAAAGCAAAAAGAGAGTGG + Intronic
1117452920 14:55868808-55868830 TTGAATAACCCAAAAGAAGAAGG - Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1119813076 14:77540375-77540397 GTGCATATGCAGGAAGAGGAAGG + Intronic
1119974507 14:79010519-79010541 TTTCACAACCCAAAAGAGGAGGG + Intronic
1120257060 14:82134033-82134055 TTGAATCTGCAAAAAGAGAAAGG - Intergenic
1123221434 14:106860490-106860512 ATGAATAAGCAAAAAGATAAGGG - Intergenic
1124433912 15:29632226-29632248 TTGGAAAAGTAAAAAGAGGCAGG - Intergenic
1124686594 15:31788311-31788333 TAGCATAAGCAAACAAGGGAAGG + Intronic
1125238038 15:37539103-37539125 TTCCATAAGCAAAAACATGGGGG - Intergenic
1125792690 15:42381054-42381076 TGTCATAAGCAAAGAAAGGAAGG - Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126718059 15:51543383-51543405 TTCCATATGCAAAATGAGAAGGG - Intronic
1126963711 15:54027706-54027728 TGTCTTAAGCAAACAGAGGATGG - Intronic
1127295552 15:57605751-57605773 TTGCAGAAGGGAAAAGATGAGGG + Intronic
1129158857 15:73735753-73735775 TTGCCTAAGGAAACACAGGATGG - Exonic
1132450507 15:101965675-101965697 TTGCAGAGGAAAAAAGAGGCTGG - Intergenic
1133833669 16:9348248-9348270 TAGCAAAAACAAAAAGTGGAGGG - Intergenic
1134341368 16:13349858-13349880 TTAAATAAGCAAAAAGACCAAGG + Intergenic
1134373730 16:13650233-13650255 TTACATAAGCAAAATGAGGTGGG + Intergenic
1135038742 16:19100861-19100883 TTACATCAGTAAAAAGATGAGGG - Intergenic
1135172301 16:20196140-20196162 TTGCAGAAAATAAAAGAGGAAGG - Intergenic
1139738999 16:69018583-69018605 ATGCATAGGAAAAAAGAGAAAGG - Intronic
1140251198 16:73295806-73295828 ATGCATAAGCAAGAAGAATAGGG + Intergenic
1140412669 16:74750584-74750606 TTGAATCAGCAAAAAGAAGTAGG - Intronic
1143906216 17:10211155-10211177 TTTCATAATAAAAAAAAGGAAGG + Intergenic
1145298879 17:21615647-21615669 TTGCAAGAGGAAAAAGAAGAGGG + Intergenic
1145730524 17:27180411-27180433 TTGCAGAAGCAAAAAAAAAAGGG + Intergenic
1147499973 17:40953619-40953641 TTGGAGAAGGAAAAAGAGAAAGG + Intergenic
1147855224 17:43474761-43474783 TTGTATCAGGAAAAAGAGAAGGG + Intergenic
1148545434 17:48515151-48515173 TTCCAAAAGGAAAAAGAGGAGGG + Intergenic
1149219609 17:54401366-54401388 TTCCACAAGAAAATAGAGGAAGG + Intergenic
1149944042 17:60901317-60901339 CTGCATAAGCAAGAAAAGAAAGG - Intronic
1152673083 17:81620666-81620688 TTTAATAATTAAAAAGAGGAGGG + Intronic
1153413380 18:4818745-4818767 TTTCCTCAGCAAAAGGAGGAAGG - Intergenic
1153446001 18:5173881-5173903 TTGCAGCCGCAAAAAGAGGGTGG + Intronic
1153482309 18:5559327-5559349 TTGCAAAGGCAAAAAGACAAAGG + Intronic
1154089809 18:11346634-11346656 TGTCATAAGCAATAAGAGGGAGG + Intergenic
1154955087 18:21245649-21245671 CTGCAAAATCAAAAACAGGAAGG - Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1157314614 18:46577219-46577241 ATGCTTAAGCAAAAAGAGAAAGG + Intronic
1157753599 18:50198885-50198907 TTGCATAAGCAAAGAAAGAGAGG + Intergenic
1158584928 18:58724456-58724478 TTTCATAAGAAAAAAATGGATGG - Intronic
1159127752 18:64244882-64244904 TTGCATAAGCATAAATGGGCGGG + Intergenic
1159764878 18:72476852-72476874 TTAAGTAAGCTAAAAGAGGAAGG - Intergenic
1160634750 19:66872-66894 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1161874435 19:6896808-6896830 TTACATGATCAAAGAGAGGAAGG - Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1163300882 19:16445441-16445463 TTGCATATGCAAAAGCAGAAGGG + Intronic
1163648320 19:18502787-18502809 TCTCAGAAGCAAAAACAGGAAGG - Intronic
1165532422 19:36415115-36415137 TTGAAAAAGGAAAAAGAGGTTGG - Intronic
1165865801 19:38937085-38937107 TTGCAAAAGCAAAAAAAAGGGGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167294557 19:48642011-48642033 TTGCAAAAGAACAAAGAGAAGGG + Intronic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925713219 2:6761829-6761851 ATGCTTAAGCAACAAGAAGAAGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
925987927 2:9231080-9231102 TGGCATAAGAAGAAAAAGGAAGG - Intronic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926270120 2:11359246-11359268 TTTCATAAGTAAAGAAAGGAGGG - Intergenic
926571919 2:14538308-14538330 TTAAATAAGCAAATAGAGGGAGG - Intergenic
927056035 2:19366242-19366264 TTGCATATGTGGAAAGAGGAGGG + Intergenic
927348203 2:22072288-22072310 TTCCAAAAAAAAAAAGAGGAGGG + Intergenic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
928541401 2:32287423-32287445 TTTAATAAGCAACAAGAGCAAGG - Intronic
929180858 2:39037220-39037242 TTTCAAAAACAACAAGAGGATGG + Intronic
929575399 2:43048824-43048846 TTTCATAAGGAAGTAGAGGAAGG - Intergenic
929799924 2:45091033-45091055 TTGAAAAAGGAAAAAGAGGGTGG - Intergenic
930763109 2:55057664-55057686 TTGAGAAAGCGAAAAGAGGATGG + Intronic
931121257 2:59222842-59222864 CTGCAAAAGCAAAGAGGGGAAGG + Intergenic
931255383 2:60567655-60567677 ATGCAAAAGGAAAAAGAGGAGGG + Intergenic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
933559621 2:83874411-83874433 TTCTATAACCAAAAAGAGGTTGG - Intergenic
935081311 2:99798432-99798454 TTGGATAAATAAAAACAGGATGG - Intronic
935190354 2:100772857-100772879 TTTCCAAAGCTAAAAGAGGAGGG + Intergenic
936368981 2:111886862-111886884 TTGCAAAAGCAAATGAAGGAGGG + Intergenic
937288337 2:120767036-120767058 TTGCAAAAGCCACAAGAGAAGGG - Intronic
937539487 2:122931077-122931099 TTGCCCAAACAAAATGAGGATGG - Intergenic
938881923 2:135599158-135599180 TTACATATGCACAAAAAGGATGG - Intronic
939339175 2:140871001-140871023 TTACATATGCTAAAAGAGTATGG + Intronic
939496946 2:142936085-142936107 TTGAATGAGGAAAAAGAGGTAGG + Intronic
940492004 2:154374514-154374536 TTGAGTAAGGAAAAAAAGGATGG + Intronic
941108317 2:161388530-161388552 TTGCAGAAGGCAAAAGAGGAAGG - Intronic
941681541 2:168404886-168404908 TTCCATAATCAAATATAGGAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941999502 2:171631975-171631997 TTACATAAGAAAAAATAGGCTGG - Intergenic
942947617 2:181686698-181686720 TTGCATAAGCAATTAGTGCAAGG - Intergenic
943587106 2:189754140-189754162 ATGAAAAAGGAAAAAGAGGAAGG - Exonic
943645323 2:190403804-190403826 TTGCAAAAGGGAAAAGGGGAAGG - Intergenic
943963592 2:194300341-194300363 ATATATAAGCAAAAAGAGGTAGG - Intergenic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
946229277 2:218281762-218281784 TTGCTGAGGCAAAAAGTGGAGGG + Intronic
947235374 2:227935926-227935948 TTGCTTAAGGAGGAAGAGGAGGG + Intergenic
947912360 2:233809607-233809629 TTTCATAAGGAACAAGAGGTGGG + Intronic
948433524 2:237936249-237936271 TTGCATCATCAAAGAGAAGATGG - Intergenic
948573497 2:238934114-238934136 TTGCAAAAGAATAAAGTGGAAGG + Intergenic
1169434686 20:5575547-5575569 TTTCATAGGAAAAAAGAGGGAGG + Intronic
1169447930 20:5688052-5688074 TTGCATGAGCAGGAAGGGGAAGG - Intergenic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1169789868 20:9398275-9398297 TTGCATAAGAGCACAGAGGAGGG + Intronic
1170111746 20:12811787-12811809 TTTCAAAAACTAAAAGAGGAGGG + Intergenic
1170507139 20:17038673-17038695 TTGCATTAGTAACAAGGGGAGGG + Intergenic
1170651903 20:18250737-18250759 TTTCATATGTAAAAAGAGTAGGG + Intergenic
1171058778 20:21934953-21934975 TTGTATTAGCAAAAAGATGTGGG - Intergenic
1173152213 20:40577228-40577250 TTGCAGATGGAAAAAGAGGGTGG + Intergenic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1174842052 20:53910232-53910254 TTTTAAAAGCAAAAAGAGGCCGG - Intergenic
1174918668 20:54679411-54679433 TTGCATAGGCAAAGCGAGGAAGG + Intergenic
1175829629 20:61955053-61955075 TTGCAAAAGCAAAGAAAAGAGGG - Intronic
1176649606 21:9532698-9532720 TTGCAAGAGGAAAAAGAAGAGGG + Intergenic
1176785151 21:13247284-13247306 TTTCTTAGGGAAAAAGAGGAAGG + Intergenic
1177030489 21:15977434-15977456 ATGCAAAAGCATAAAGAGGGAGG - Intergenic
1177153666 21:17480164-17480186 TTGAAACAGCAAACAGAGGATGG - Intergenic
1180674574 22:17578410-17578432 TTGGGTAAGAAAAGAGAGGAGGG - Intronic
1181882077 22:25989137-25989159 TCACCTAAGCAAAACGAGGAGGG + Intronic
1183131296 22:35839359-35839381 TGGCATAACCAAAAAGAGGCAGG + Intronic
1183234168 22:36604633-36604655 CTCCATCAGCAAAAAGATGATGG + Intronic
1183272382 22:36870299-36870321 ATGCATTAGTAAAGAGAGGAGGG + Intronic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
949755235 3:7401894-7401916 TTGCCTAAGGTAAAAAAGGAGGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950697747 3:14716610-14716632 TTGCACTGGCAAAGAGAGGAGGG - Intronic
951705741 3:25542687-25542709 TTGCACAAGGGAACAGAGGAGGG - Intronic
955274018 3:57530314-57530336 TTACATAAGCAAATACAGAAAGG + Intronic
956794371 3:72704677-72704699 TGGCTTAAGCAAAAAAAGGAGGG + Intergenic
957479827 3:80777379-80777401 TTACTAAGGCAAAAAGAGGAAGG - Intergenic
957690460 3:83559215-83559237 TTGCCTAGGTAAAAAGAGGAAGG + Intergenic
958068909 3:88583904-88583926 TTGCATAAGAACACAGAGTAGGG + Intergenic
958935645 3:100252879-100252901 TTTCAAAAGAAAAAAGAAGAAGG - Intergenic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
959912542 3:111779806-111779828 TAGCAAAGGCAAAAAGAGGATGG - Intronic
961529047 3:127528635-127528657 TTGCATATAGAAGAAGAGGAGGG + Intergenic
961699235 3:128729029-128729051 CTGCATAAGTAAACAGAGGGTGG + Intronic
961834907 3:129649602-129649624 TTGCCAAAGCAAAAGGAGGCTGG + Exonic
961919068 3:130407186-130407208 TAGCATAAGCAAAAACATGAGGG + Intronic
961922023 3:130436831-130436853 TTGCATAAGGATAGAGAAGAGGG - Intronic
962205194 3:133428479-133428501 TTCCAAAAAAAAAAAGAGGATGG + Intronic
963706895 3:148698716-148698738 TTGAATAATCAAACTGAGGAAGG + Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965691684 3:171363888-171363910 TTGAATAAGCCAAAACAGGCGGG + Intronic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966384230 3:179378344-179378366 TTAAATAAGCACATAGAGGATGG + Exonic
967192610 3:186997948-186997970 TTAAAAAAGCAAAAAGAGGCCGG + Intronic
967444784 3:189554525-189554547 TTGCAGAGACAACAAGAGGATGG - Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
970910138 4:21265272-21265294 TTGCATAAGAAGTGAGAGGATGG + Intronic
970964650 4:21914216-21914238 GAGCATAAGCCAAAAGATGATGG + Intronic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
972019275 4:34288981-34289003 TTTCATTAGAAGAAAGAGGAAGG + Intergenic
973151198 4:46890320-46890342 TGGCATAGGCAAAAAGAATATGG - Intronic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
975282970 4:72584394-72584416 GTGCATGAGCATAAAGATGAAGG - Intergenic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
975878934 4:78878699-78878721 TTGAGTAAGAAAAAAGAAGATGG - Intronic
976306155 4:83561444-83561466 TTGCAGAGGCAAGAAGAAGAAGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
978249821 4:106617210-106617232 TTACATCAGCAAAACAAGGATGG - Intergenic
978299135 4:107245939-107245961 TTGTTTCAGCAACAAGAGGAAGG - Intronic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980847046 4:138336206-138336228 TTCCATAATCCAAAAGAGAAAGG + Intergenic
980897844 4:138876752-138876774 TTGCATCATCCCAAAGAGGATGG - Intergenic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
981736669 4:147960521-147960543 TTTCATTACCAAAAAAAGGAAGG + Intronic
981781314 4:148433954-148433976 TTCCATAAGCAAGAAAAGCAAGG + Intronic
981800529 4:148650128-148650150 TTGCATAAGCAAAAACACAGAGG + Intergenic
982030632 4:151297088-151297110 TTGCTTCAGGAAAAGGAGGAAGG + Intronic
983932990 4:173473622-173473644 GTGCATAAGGAAAAAGAGGCAGG + Intergenic
985147788 4:186912061-186912083 TTGCAGAAGAGAAAAAAGGAAGG - Intergenic
985987374 5:3527386-3527408 TGGCAGATGCAAAGAGAGGAGGG + Intergenic
989727284 5:44601635-44601657 TTGCAGAAGCAAAAAGGAGGAGG - Intergenic
990147720 5:52781470-52781492 TTCCAGAAAAAAAAAGAGGAGGG + Intergenic
990338218 5:54795776-54795798 TGTCATAAGCCAAAGGAGGAAGG - Intergenic
990977777 5:61574387-61574409 TTGCTTAAAGAAAAAGAGGCTGG + Intergenic
990999975 5:61772809-61772831 TTGTAAAGGCAAAAAGAGCATGG - Intergenic
991544708 5:67768823-67768845 TTACAAAAGTAAAAAGAAGAGGG + Intergenic
991654980 5:68894969-68894991 ATACATAAGCAATAACAGGAAGG - Intergenic
991700730 5:69313875-69313897 TTCCAGAAGCAAAAAGGAGAGGG + Intronic
992358939 5:76016213-76016235 GTGCAGCAGAAAAAAGAGGAAGG + Intergenic
992442162 5:76806466-76806488 GTGGATGAGCCAAAAGAGGAGGG - Intergenic
993375042 5:87141022-87141044 TTGCACTAACAAAAAGAGGAAGG + Intergenic
993525696 5:88963228-88963250 TTTCACATGCAAAAAGAGTATGG + Intergenic
993748368 5:91630869-91630891 TTGCATAAGCAAAGAGATTTGGG + Intergenic
993874769 5:93293407-93293429 TTTTATAAGCAAATAGAGGCTGG - Intergenic
995037082 5:107546337-107546359 ATCCATAAGCAGAAAGAGGCTGG + Intronic
995137613 5:108696879-108696901 TTGCTTAAGTAAAAATAGCAGGG + Intergenic
996104586 5:119484490-119484512 TTGCATAAGTAAATAAAGGTAGG - Intronic
997045874 5:130316981-130317003 TTCTATAGGCAAAAAGAGGCAGG + Intergenic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998883638 5:146671396-146671418 TTGCATAAACAAATAGAGCTGGG + Intronic
999006022 5:147980206-147980228 TTGTACAAGCAAAAACAAGATGG - Intergenic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000822469 5:166001627-166001649 TTGTAAAAGCAAAAATAGGCTGG + Intergenic
1001965083 5:175904331-175904353 CTGCATAATCAAAAACAGCACGG + Intergenic
1002251872 5:177934857-177934879 CTGCATAATCAAAAACAGCACGG - Intergenic
1004490478 6:16110315-16110337 TGGCAAAAGCAGAAATAGGAAGG + Intergenic
1004528447 6:16430912-16430934 TTACAGAAGAAAAAAGAGGCGGG + Intronic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1005808987 6:29502135-29502157 TTGCATGACCAAAGGGAGGAGGG + Intergenic
1005824662 6:29625557-29625579 TTGCAAGAGCAAAGAGAGGGAGG - Intronic
1006264170 6:32903355-32903377 TTGCATCATCACACAGAGGAAGG - Intergenic
1007814916 6:44514919-44514941 TTGCCCCAGAAAAAAGAGGAAGG + Intergenic
1008786987 6:55180349-55180371 ATGCATAGGCAAAAAGAGGAAGG + Intronic
1008897362 6:56571845-56571867 TTGCATAAGAAAAACGATGGCGG - Intronic
1009863407 6:69365286-69365308 TTCCAAAAGCAGAAAGAGTAAGG - Intronic
1010275584 6:73965192-73965214 TTGCATGAGAAGAAACAGGATGG + Intergenic
1010499136 6:76573294-76573316 TTGAATAATCACAAAGAGCAGGG + Intergenic
1012110612 6:95226651-95226673 TGGCAGAAGAAAAAAGTGGAAGG - Intergenic
1012860902 6:104558034-104558056 ATGCACAAGCAAAAATAGAAAGG + Intergenic
1013277003 6:108594907-108594929 TTGCATAAGCACATAAAGGAAGG - Intronic
1013309559 6:108880538-108880560 GTACATAAACAAAAAGAGCAAGG + Intronic
1013822970 6:114177438-114177460 TTGCATTAGCAAAAGCAGGGTGG - Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1015208152 6:130665503-130665525 TTGAATTACCGAAAAGAGGAAGG + Intergenic
1015465850 6:133547884-133547906 TGGCATAAACAAAGATAGGAAGG - Intergenic
1016731850 6:147436038-147436060 TTGCAGAAGGACAAAGAGAAGGG - Intergenic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017297357 6:152813614-152813636 TTGGATAAGCAAAAGGATGCTGG + Intergenic
1017533519 6:155321886-155321908 TCACATAAGTAAAAGGAGGATGG - Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018465745 6:164043153-164043175 TTGGATAAACAAAAAGAATAAGG - Intergenic
1018576355 6:165264178-165264200 TGGCCTAAGCAAACAAAGGAAGG + Intergenic
1018738102 6:166704832-166704854 TGTAATAAGGAAAAAGAGGAAGG - Intronic
1020533717 7:9367163-9367185 TTGCATAAACAACAAAATGAAGG + Intergenic
1021057146 7:16063269-16063291 TCACAGAGGCAAAAAGAGGAAGG + Intergenic
1021239022 7:18177964-18177986 ATGAATAAGCAAAAAGAAAAGGG - Intronic
1021285225 7:18772464-18772486 TTACATCAGCAGAAAGAGGAGGG + Intronic
1022309880 7:29186875-29186897 TTTCTTAACCAAAAAGAGCAGGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023085848 7:36569237-36569259 TTGCTAAAACAAAATGAGGAAGG + Intronic
1023267691 7:38425169-38425191 TTGCATCAGAAAACAGTGGAAGG + Intronic
1023451274 7:40288206-40288228 TTCCAAAAGCAAGGAGAGGAGGG - Intronic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026078559 7:67196565-67196587 TTCCATAAGGAAAAAGTGAAAGG - Intronic
1026418273 7:70205850-70205872 TAGCATAAGCTTTAAGAGGAGGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027950769 7:84812059-84812081 TTGCTTAAATAAAAATAGGAAGG - Intergenic
1028014629 7:85691570-85691592 TTGCATCAGCTATAAGAGAAAGG - Intergenic
1029871024 7:103692837-103692859 TTCCACTAGCACAAAGAGGAGGG + Intronic
1030589492 7:111463654-111463676 TGGCAGAAGGAAAAAGAGGTGGG - Intronic
1030613115 7:111710299-111710321 TATCCTAAGCAAAAAGAAGAGGG + Intergenic
1031228825 7:119077763-119077785 TACCATAAGCATTAAGAGGATGG + Intergenic
1031376669 7:121035007-121035029 TTTCTTAAGCAAATATAGGAGGG + Intronic
1033268366 7:139907545-139907567 TTCCAGAAGATAAAAGAGGAGGG - Intronic
1033676755 7:143548504-143548526 TTCCATAAGATAAAAGGGGAGGG - Intergenic
1034083178 7:148299376-148299398 TTGCATCAGAAACTAGAGGAGGG + Intronic
1034317148 7:150143259-150143281 TTGCATAATCAAAATCAAGAGGG + Intergenic
1036221768 8:6927051-6927073 TTGTATATGCCAAAAGAGAAGGG + Intergenic
1037229967 8:16646176-16646198 TTCCAGAAGCAAAAGGAAGAGGG + Intergenic
1037349714 8:17938816-17938838 CTGCATAGGCAAAAAGTTGAAGG - Exonic
1038146920 8:24905664-24905686 TTGTATAGGGAAGAAGAGGAGGG - Intergenic
1038884712 8:31650464-31650486 TGGCATATGTAAAAACAGGAGGG - Intronic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039316886 8:36383450-36383472 GTACATAAGCCAAAAGATGAGGG + Intergenic
1039653079 8:39365062-39365084 TTGCATAAAATAGAAGAGGAAGG + Intergenic
1040375752 8:46823062-46823084 TTTCATAATCACAGAGAGGAGGG + Intergenic
1042341377 8:67683667-67683689 TTGAATAGGCATAAAGAAGAGGG - Intronic
1042508215 8:69583930-69583952 TTGCACAAGCAAAAATAGAGAGG + Intronic
1043096630 8:75983652-75983674 TTGCAAAAGAAAAAAGAGTTTGG + Intergenic
1043104624 8:76091620-76091642 TTGAATAAGGACAAAGATGAAGG - Intergenic
1043291102 8:78602347-78602369 TTTCATAAGCAATCAGAGAAGGG - Exonic
1043591580 8:81839983-81840005 TTGGAAAAGCCAAAAGAAGATGG - Exonic
1044867871 8:96590159-96590181 TTGCATCAGCCAAAAGGGAAAGG + Intronic
1045161061 8:99544610-99544632 TTGCATAAGCAAAAAGCGGTAGG - Intronic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1047128197 8:121986910-121986932 TTGCTCATGCTAAAAGAGGAGGG + Intergenic
1047816605 8:128471116-128471138 TTCCATTAGCTTAAAGAGGAAGG - Intergenic
1048736948 8:137512747-137512769 TTGCATTAACACAAAGGGGATGG + Intergenic
1048802779 8:138209397-138209419 ATACATAAGGAATAAGAGGAGGG + Intronic
1049885803 9:25377-25399 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1050278793 9:4028892-4028914 TTGCATAAGGAATAAGAGAAGGG - Intronic
1051027204 9:12626931-12626953 TTGCACATGCAAAAGGAAGAAGG - Intergenic
1051137594 9:13940059-13940081 TTGCATAAAGATAAAAAGGAAGG - Intergenic
1052582364 9:30374249-30374271 TTGCAGAAAATAAAAGAGGAGGG + Intergenic
1053004605 9:34596151-34596173 TACTATAAGGAAAAAGAGGATGG - Intergenic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055309173 9:74960692-74960714 TTCCATGAGCAAAAAGACTACGG - Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1056942306 9:90966035-90966057 TTGCATATGGAAAATCAGGAAGG + Intergenic
1057882662 9:98804872-98804894 GTAAATAAGCAAAAAAAGGAAGG - Intergenic
1058265476 9:102893649-102893671 TTCCAAAAGCAAAATGAAGATGG - Intergenic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1058806396 9:108596384-108596406 TTGCATTAACCAAAAGTGGATGG + Intergenic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1061367383 9:130178934-130178956 TTTCAAAAAAAAAAAGAGGAGGG - Intronic
1203627347 Un_KI270750v1:36246-36268 TTGCAAGAGGAAAAAGAAGAGGG + Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186696000 X:12032695-12032717 TGGCATAAGCAAAACGATGATGG + Intergenic
1186724430 X:12342211-12342233 TTCCATAATCTAAAAGAGGAAGG + Intronic
1187244724 X:17543808-17543830 TATCAAAAGGAAAAAGAGGAGGG - Intronic
1188150285 X:26666218-26666240 TAGCATAAGCAAAAATTAGAAGG + Intergenic
1190299081 X:49045741-49045763 TTACAAAAGAAGAAAGAGGAGGG + Intergenic
1190734315 X:53245729-53245751 TAGAATAAGCAAAAAGAGCAAGG + Intronic
1193006319 X:76622565-76622587 AATCATAAGCAAAAAGAGCAGGG + Intergenic
1194370701 X:93067534-93067556 TTGGAAAACCAAAAAGAGCAAGG + Intergenic
1195011671 X:100738166-100738188 GAGCATAAGCAAAAACAGAAAGG + Intergenic
1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG + Intergenic
1196418569 X:115499476-115499498 TTTCAGAAGCCAAAAGAGGGAGG + Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1197664901 X:129212922-129212944 TTGCAGAATCAAAAAGAATAAGG - Intergenic
1198101348 X:133424813-133424835 TTGCACAGGCAAAAAGAGACAGG + Intergenic
1198635869 X:138699639-138699661 TTGCAAAAGCTAAATGGGGAAGG - Intronic
1198892465 X:141413496-141413518 TGGCATAGGCAAAATGAGTAGGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1199730991 X:150632039-150632061 TTGCTTAAGCAACAATAGAAAGG - Intronic
1200678493 Y:6179427-6179449 TTGGAAAACCAAAAAGAGCAAGG + Intergenic
1201770691 Y:17614622-17614644 TTCTATAACCAAAAAGAGGTTGG + Intergenic
1201830864 Y:18291364-18291386 TTCTATAACCAAAAAGAGGTTGG - Intergenic