ID: 1199707089

View in Genome Browser
Species Human (GRCh38)
Location X:150437126-150437148
Sequence GGTCACAACACTGCAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 1, 2: 12, 3: 44, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199707083_1199707089 16 Left 1199707083 X:150437087-150437109 CCTGCTGTGCTGAAGGGGCTGAG 0: 4
1: 11
2: 22
3: 87
4: 391
Right 1199707089 X:150437126-150437148 GGTCACAACACTGCAATGGATGG 0: 1
1: 1
2: 12
3: 44
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199707089 Original CRISPR GGTCACAACACTGCAATGGA TGG Intronic
902265106 1:15257655-15257677 GTTCCCAACACAGCAATGCATGG + Intronic
903542895 1:24106922-24106944 GGTCACACCACTGGAATGTAGGG + Intronic
904055422 1:27666878-27666900 GGCCACACCCCTGCAATGGGAGG - Intronic
904612310 1:31732411-31732433 TGTCCCAACCCTGCCATGGATGG + Intronic
906003642 1:42449110-42449132 TGTCATAACACTAAAATGGATGG + Intronic
907027165 1:51131849-51131871 GGTCACTACACTCTAATGGGTGG - Intronic
909203709 1:72725900-72725922 GGTCACTACACTCCAATGGATGG - Intergenic
910657154 1:89631464-89631486 GGTCACAACCCTCCTGTGGAGGG - Intergenic
911311529 1:96297842-96297864 GGTCACTACACTCCAATGAGTGG + Intergenic
912594832 1:110864313-110864335 GGCCACAACACTCCAATGGGTGG - Intergenic
913179533 1:116308131-116308153 GGACAGAACACTTCAATGGCAGG + Intergenic
913349660 1:117843187-117843209 GGTCACTACACTTCAATGGGTGG - Intergenic
916338023 1:163695028-163695050 GGTCACAAGTCTGATATGGATGG - Intergenic
916392158 1:164342525-164342547 GGCAACAACACTCCAATGGGAGG - Intergenic
917755824 1:178096687-178096709 GGTCACAAAAATGCAAGGCATGG - Intronic
918336314 1:183517712-183517734 GATCACAACACTGCAAGGCCAGG + Exonic
918949052 1:191110999-191111021 GGGCACAACATTGCAATGGGTGG + Intergenic
921104281 1:211960050-211960072 GGTTACTACACTCCAATGGGTGG - Intronic
921800624 1:219398953-219398975 AGTCACTACACTCCAATGGATGG + Intergenic
924331793 1:242946892-242946914 GGGCACTACACTGTGATGGATGG - Intergenic
1063906207 10:10782733-10782755 GGTCACAAGAGAGCAAAGGAAGG - Intergenic
1066176282 10:32910790-32910812 GGTCACACCACTGCACTGCCTGG - Intronic
1068285536 10:54929325-54929347 GGTCACTACACTTCAATGGGTGG + Intronic
1069314962 10:67086912-67086934 AGTCACAACAGTCCACTGGAGGG - Intronic
1069805896 10:71124868-71124890 GGTCACTACACTCCAATGGGTGG + Intergenic
1071242262 10:83720461-83720483 TGTCACAAGACTGTAATGGTGGG + Intergenic
1071256186 10:83873863-83873885 GGTCACAGCACTGGAGAGGATGG - Intergenic
1071358010 10:84817867-84817889 GGCCACAACACTCTAATGGGTGG + Intergenic
1072839332 10:98753597-98753619 GGCCACAACACTCTGATGGAAGG - Intronic
1073564946 10:104526920-104526942 AGTGACAACAGTGCAAAGGATGG - Intergenic
1076334564 10:129696866-129696888 GGCCACAACACTGCACTCAATGG - Intronic
1082092849 11:48103975-48103997 GGTCCCAAAAATGCCATGGAAGG - Intronic
1084925768 11:72510331-72510353 GGCCACAACACTCCAATGAGTGG + Intergenic
1085731456 11:79002398-79002420 GGCCACAACACTCCAATGGGTGG - Intronic
1085856374 11:80180985-80181007 GGTCACTACACTTCTATGGGTGG + Intergenic
1086956210 11:92936805-92936827 ATTCACAACACTGTAATGCAAGG - Intergenic
1087868776 11:103266112-103266134 GGTCACTACACTGCGATAGGTGG + Intronic
1090217570 11:124983680-124983702 GGTCACAACACACTGATGGATGG + Intronic
1090684585 11:129100983-129101005 GGTCACTACACTCCAATGGGTGG - Intronic
1091529228 12:1338950-1338972 GGTCACTACACTCTAATGGGTGG + Intronic
1091757974 12:3067780-3067802 GGTCACAGCACAGCATAGGATGG - Intergenic
1091941590 12:4488721-4488743 GGCCACAAGAATGAAATGGAGGG - Exonic
1092040635 12:5380937-5380959 GGGCAAAACAGTGCAAGGGAGGG - Intergenic
1092075646 12:5671156-5671178 GGTCCCAGCACTGGAAAGGAAGG - Intronic
1092333694 12:7608882-7608904 GGTCACAACACTTTGATGGATGG - Intergenic
1093490789 12:19701519-19701541 GGCCACAACACTCCAATGAAGGG - Intronic
1094289703 12:28833340-28833362 GGTCACAACACTCTGATGGGGGG - Intergenic
1098889932 12:75999582-75999604 GGCCTCAACACTTCAGTGGAGGG - Intergenic
1099394613 12:82121824-82121846 GGTCAAAACACTCCAATGGGTGG - Intergenic
1099585066 12:84505145-84505167 GGACACAAGACTACAAAGGAAGG - Intergenic
1101471146 12:104998582-104998604 GGTCAGAACACTTCAATGGGTGG + Intronic
1101964816 12:109275162-109275184 GGTCATTACAGTGCCATGGAGGG + Intergenic
1102026270 12:109715596-109715618 GGTCAGAGGACTGCAATGGTAGG - Intronic
1106645519 13:31629791-31629813 GGTACCAACACTGCCATGGTGGG - Intergenic
1107389200 13:39945575-39945597 GGTCACAACACTCTCATGGGTGG - Intergenic
1108839453 13:54593815-54593837 GGTCACAATACTTCAACAGATGG - Intergenic
1108903051 13:55436289-55436311 GAACACAACACTGCCATAGATGG - Intergenic
1109476557 13:62886954-62886976 GGCCACAACAATCCAATGGGTGG + Intergenic
1109569229 13:64164432-64164454 GGCCACAACACTCTGATGGATGG + Intergenic
1114933572 14:27506320-27506342 GGTCACTACACTTCAATGGGTGG + Intergenic
1116278270 14:42865930-42865952 CTTCACAACTCTGCATTGGAGGG - Intergenic
1116615961 14:47139364-47139386 CTACACAACACTGCTATGGAGGG - Intronic
1118448723 14:65877208-65877230 GGTCACTACACTCCGATGGGTGG + Intergenic
1121560453 14:94871174-94871196 GGACACAACATTTCAACGGAAGG - Intergenic
1123586530 15:21765377-21765399 GGTCCCAGCACTGGAAAGGAAGG + Intergenic
1123623169 15:22207942-22207964 GGTCCCAGCACTGGAAAGGAAGG + Intergenic
1123875656 15:24621603-24621625 GGCCAGAACACTCCAATGGGTGG + Intergenic
1126427099 15:48539431-48539453 GGACATAACACTGGCATGGAGGG - Intronic
1127517466 15:59710204-59710226 GCTCAGAACCTTGCAATGGATGG - Intergenic
1127633126 15:60844615-60844637 GATCACCATACTGCAAAGGAAGG + Intronic
1129560687 15:76563824-76563846 GGTCTCATCTCTGGAATGGAAGG + Intronic
1129572152 15:76699725-76699747 GGCAACAACACTTCAATGGCGGG + Intronic
1129931270 15:79412806-79412828 GGTCACAACACTCCAATGGGTGG - Intronic
1132042372 15:98536119-98536141 GGCCACAACACTCCAGTGGGGGG - Intergenic
1134429581 16:14190689-14190711 GGTTAAAACACTGCGATTGAGGG - Intronic
1137508789 16:49080088-49080110 GGTCACTGCACTGCTATTGATGG + Intergenic
1138458356 16:57133832-57133854 CCTCACAACACCCCAATGGAAGG - Intronic
1138764237 16:59582026-59582048 GATTCCAACAGTGCAATGGAAGG + Intergenic
1138976415 16:62213824-62213846 GGTCACCACACTCCAATGGGTGG + Intergenic
1141053590 16:80795469-80795491 GGTCACACCACTCCAGTGAAAGG - Intronic
1141307300 16:82877562-82877584 GGTAACAGCAATGCAATGGGGGG + Intronic
1142021263 16:87784158-87784180 GGTCACAACACGACGATGGGAGG - Intergenic
1150940502 17:69688055-69688077 GGTCACAACACTCTGATGGGTGG + Intergenic
1152058715 17:78052434-78052456 AGTCAAAACCCTGCCATGGAGGG + Intronic
1152632520 17:81416971-81416993 GGGGACAACACGGCAACGGATGG - Intronic
1154019277 18:10648335-10648357 GGTCACTACACTCCAATGGGTGG - Intergenic
1154184941 18:12174898-12174920 GGTCACTACACTCCAATGGGTGG + Intergenic
1155844958 18:30694840-30694862 GGTCACAACACTCCAGTGGATGG + Intergenic
1158825035 18:61209018-61209040 GATGACAACACCGCAAAGGATGG + Intergenic
1158939873 18:62397541-62397563 GTTTACAACACAGCAATGCATGG + Intergenic
1159905971 18:74092782-74092804 GGTCACAACACTCTGATGGGTGG + Intronic
1163265225 19:16216835-16216857 GGTCACAACACTCCAATGGGTGG + Intronic
1165060304 19:33201836-33201858 GCTCACCACACTGCCCTGGATGG + Intronic
1166585934 19:43949055-43949077 GGTCACTGCACTACAATGGATGG + Intergenic
927148113 2:20180103-20180125 GGTCTCATCCCAGCAATGGATGG - Intergenic
928447779 2:31348237-31348259 GGACACAACACTGCCAGAGAGGG + Intronic
930513805 2:52380547-52380569 GTTCACAACAGTGCACTGGTTGG + Intergenic
930930474 2:56875624-56875646 GGTCACCAAACTCCAATGGATGG - Intergenic
931397018 2:61896533-61896555 GATCACACCACTGCACTGGGTGG + Intronic
931921259 2:67018555-67018577 TGCCACAACACTCCAATGGGTGG - Intergenic
932730595 2:74219145-74219167 GCAAAGAACACTGCAATGGATGG - Intronic
933579867 2:84113356-84113378 GGGCACAAGACAGCTATGGATGG - Intergenic
934099788 2:88641619-88641641 CGTCACTACACTGCAATAGGTGG - Intergenic
934219023 2:90064625-90064647 GGTCACAACACTTCTGTGGGTGG + Intergenic
934996553 2:98967047-98967069 GGTCACAACACTACAATGGCTGG + Intergenic
936703203 2:115038719-115038741 TGTCACAACCCTGTAATGGAGGG + Intronic
936812110 2:116414176-116414198 GGCCACAACACTCCAGTGGGTGG - Intergenic
940903743 2:159149842-159149864 GGTCTCTGCACTGCAAGGGAGGG + Intronic
941054996 2:160777231-160777253 GGCAACAACACTCCAATGGAGGG - Intergenic
942855460 2:180541057-180541079 GTTCAAAACACTGCAATGGCTGG - Intergenic
944436599 2:199696391-199696413 GGCAACAACACTTCAATGGCAGG - Intergenic
945430305 2:209755724-209755746 GGCAACAATACTGCAATGGTGGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948270642 2:236670733-236670755 GGGCACAAGACTGCACTGAAGGG - Intergenic
948501349 2:238397235-238397257 GGACACAGCACTGCCAGGGAGGG - Intronic
1170487100 20:16829482-16829504 GGTCACAAAGGTGAAATGGAAGG - Intergenic
1173218492 20:41111068-41111090 AGTCACACCACTGGAATGTAAGG - Intronic
1173776565 20:45713718-45713740 GGTCACAGCACTGCTGAGGAAGG + Intergenic
1174839826 20:53891204-53891226 GCTCCCAACACTGCAGGGGAGGG + Intergenic
1177043790 21:16145495-16145517 GGTCACTACACTTCAATGAGTGG + Intergenic
1177172600 21:17670669-17670691 GGACACAATACTGCAAGGTATGG + Intergenic
1178765491 21:35447022-35447044 GATCGCAGCACTGCAGTGGATGG - Intronic
949743499 3:7263327-7263349 GGTCACAACACTTAGATGGGTGG + Intronic
949839545 3:8305012-8305034 GGTCACAGCACTGCATGGGCTGG + Intergenic
953663503 3:44908047-44908069 TGTAACTATACTGCAATGGAGGG - Intronic
954412920 3:50378930-50378952 CGTCACACCGCTGCAGTGGATGG - Exonic
956267861 3:67417874-67417896 AGCCTCAACAATGCAATGGAGGG - Intronic
956371886 3:68571662-68571684 AGTCACAATACTCCAATGGGTGG - Intergenic
959041286 3:101425250-101425272 GGTCACTACTCTCCAATGGGTGG - Intronic
959169881 3:102831314-102831336 GGTCACAACACTTCAATGGTTGG - Intergenic
959421696 3:106136268-106136290 GGTCACTACATTCCAATGGGTGG - Intergenic
960012659 3:112850021-112850043 GGTTACAACACTCTAATGGGTGG - Intergenic
961774138 3:129271990-129272012 GGTCCCCACACTGCATTGGTTGG + Intronic
961988147 3:131158876-131158898 GGTCACTACACTCTGATGGATGG - Intronic
962006042 3:131351215-131351237 CATCACAACACGGCAATGAAGGG + Intergenic
964296434 3:155239409-155239431 GGTCACAACACTCCAATAGGTGG + Intergenic
965796353 3:172443539-172443561 GTTCACAACTATGGAATGGATGG - Intergenic
966714191 3:182999805-182999827 GGTCACTACACTCTGATGGATGG + Intergenic
969669946 4:8584356-8584378 GGAAACAACACTGCAAAGGCAGG - Intronic
970221192 4:13813180-13813202 GGTCTCAAGACTCCAAGGGAGGG - Intergenic
971884927 4:32432232-32432254 GGTCACAACATTCCAAGGGGTGG - Intergenic
973187964 4:47353299-47353321 GGAGAAAACACTGAAATGGAAGG - Intronic
973673722 4:53242220-53242242 GGTCACAACACTCTGATGGGTGG - Intronic
974723653 4:65773069-65773091 GGTCACTACACTCCAATAGGTGG + Intergenic
976948407 4:90798906-90798928 GGTCACAACACTCTGATGGGTGG + Intronic
977696590 4:99972325-99972347 ATTCACAACACTCCAATGGGTGG - Intergenic
978689014 4:111484110-111484132 GGTCACTACACTACAATGGGTGG - Intergenic
979158495 4:117429092-117429114 AGTTACTACACTCCAATGGATGG + Intergenic
981454008 4:144932977-144932999 GGTCACTACACTTCTATGGGTGG + Intergenic
981585147 4:146292621-146292643 GTTAAAAACATTGCAATGGATGG + Intronic
982736523 4:159012496-159012518 GGTGAGAACACTGCTAGGGAAGG + Intronic
982878980 4:160686501-160686523 GGTCACAACACTCTGATGGGTGG - Intergenic
985725390 5:1513382-1513404 GGTCACCAGGCAGCAATGGAAGG - Intronic
986244772 5:5997508-5997530 GGCAACAACACTCCAATAGAGGG + Intergenic
986349096 5:6860221-6860243 GGTCACAACCCAGAAAGGGAGGG - Intergenic
988635703 5:32981685-32981707 GGTCAAAACACTGAAAAGGAAGG + Intergenic
989193403 5:38692827-38692849 GGAGACAACACAGGAATGGATGG - Intergenic
989481771 5:41939120-41939142 GGTCCAAACACTCCAATAGAAGG + Intronic
994573016 5:101537813-101537835 GGCCACAACACTTCAATGGTTGG - Intergenic
994643002 5:102433662-102433684 GGTCACAACACTCCAATGGACGG + Intronic
994851583 5:105060795-105060817 GAGCAGAACACTGTAATGGAGGG + Intergenic
995488070 5:112659053-112659075 GGCCACAACACTCCAATGAGTGG - Intergenic
996415110 5:123202369-123202391 GGTCACAAATTTGCAATGTAAGG - Intergenic
997021551 5:130008230-130008252 GGCAACAACACTCCAATGGGGGG - Intronic
998755893 5:145379230-145379252 GGTCACTGCACTCCAATGGGTGG + Intergenic
999020778 5:148163481-148163503 GGCCACACCAATGCAAGGGATGG + Intergenic
1001537262 5:172506999-172507021 GCTCTCAACCCTGCAATGGCTGG + Intergenic
1002562568 5:180092264-180092286 AGTCTCCACTCTGCAATGGAAGG + Intergenic
1003678011 6:8224860-8224882 GGTCACAAAACTGCACAGGCTGG + Intergenic
1004048475 6:12049299-12049321 GGTCAGAACCCTGCAGAGGAAGG - Intronic
1004834100 6:19511426-19511448 GGTCACTACACTCCAATGAGTGG + Intergenic
1006253064 6:32807121-32807143 GGTCACTACACTCCAATGAGTGG + Intergenic
1011870523 6:91886642-91886664 GGTCACATCAATGCAAGAGATGG - Intergenic
1012499385 6:99871823-99871845 GGTCCCAACACTAAACTGGAAGG - Intergenic
1014854402 6:126381736-126381758 GGTCACAACACTATGATGGGCGG - Intergenic
1015246927 6:131085333-131085355 GGTCACTACACTTCAATGGGTGG - Intergenic
1016663702 6:146610744-146610766 GGCAACAACACTCCAATGGGGGG + Intronic
1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG + Intronic
1021425710 7:20496689-20496711 GGTCACAACACTTCAATGGGTGG - Intergenic
1021684804 7:23174067-23174089 GGTCTCACCAATGCCATGGAAGG + Exonic
1022877877 7:34553345-34553367 GGTCACAACACTCCAATGGGTGG - Intergenic
1023282025 7:38580609-38580631 GGTCATAGCACTGATATGGAGGG - Intronic
1026433504 7:70372001-70372023 AGTCACAAAACTGGAAAGGATGG + Intronic
1028177373 7:87674111-87674133 GGTCACAATACTCCTATGGGTGG + Intronic
1028639926 7:93030284-93030306 GGGCACAACACTGCAATGAGTGG - Intergenic
1030776999 7:113546430-113546452 GGTAAGAACACTGCACTGTAGGG + Intergenic
1031294452 7:119983899-119983921 GGTCACAACACTCTGATGGGTGG - Intergenic
1032552843 7:132801938-132801960 GGTCCTAACACTGGAGTGGAAGG - Intronic
1034366360 7:150551887-150551909 GGTAACAACACTCCAATGAGTGG - Intergenic
1036288813 8:7468962-7468984 GGTCTCAACACTGCAATTACAGG - Intergenic
1036332662 8:7842566-7842588 GGTCTCAACACTGCAATTACAGG + Intergenic
1037155566 8:15694822-15694844 GGTCACAACACTCCCATGAGTGG + Intronic
1037373496 8:18205082-18205104 GGTCACTACACTCCGATGGGTGG + Intronic
1039218907 8:35306058-35306080 GTAAACAACACTGCAATAGAAGG + Intronic
1040729008 8:50419899-50419921 GGGCACAACAGCACAATGGACGG + Intronic
1040760274 8:50833170-50833192 GGTCACAACACTCGGATGGGTGG - Intergenic
1041429147 8:57759303-57759325 GGCCACAACACTCCAATGGGTGG - Intergenic
1041806286 8:61853393-61853415 TGTCACCTCACAGCAATGGAAGG - Intergenic
1041911694 8:63095744-63095766 GGTCATAAGACTCAAATGGAAGG + Intergenic
1042156970 8:65854538-65854560 GGTCACCACACTGGCTTGGAAGG + Intergenic
1042976633 8:74477690-74477712 GGTCACAACACTCTAATGGGTGG + Intronic
1043131802 8:76472103-76472125 GGCCACAACACTTCAATGGGTGG + Intergenic
1043656645 8:82675068-82675090 GATCACTACACTCCAATGGGTGG - Intergenic
1043738418 8:83775837-83775859 GGTCACAACACTCCCATGGGTGG - Intergenic
1044793588 8:95872882-95872904 GGTCACTACACTCTAATGGGTGG - Intergenic
1048029396 8:130616682-130616704 GGTCACTACACTCCAATGGATGG - Intergenic
1048119381 8:131563045-131563067 GGTCACAATGCTACAATGGGTGG + Intergenic
1048544177 8:135370724-135370746 GGTCACTAAACTACATTGGAGGG + Intergenic
1049128202 8:140811142-140811164 GGTCACTACACTCCAATGGGTGG - Intronic
1049297707 8:141851936-141851958 GGTGACAACCCTGCAGGGGACGG + Intergenic
1050102196 9:2130591-2130613 AGTTACAAAACTGTAATGGATGG - Intronic
1050475418 9:6035344-6035366 GGTCACAACACTGTGATGGATGG - Intergenic
1051096908 9:13477028-13477050 GAACACAATACTGTAATGGATGG + Intergenic
1051110335 9:13627897-13627919 AGTCACGACACTCCAATGGGTGG - Intergenic
1051292924 9:15563490-15563512 CCTTACAACACTGCAATGTAAGG - Intronic
1051594999 9:18816281-18816303 GGTCACACCACTGCACTCCAGGG - Intronic
1051952640 9:22655381-22655403 TGTCTGAACACTGGAATGGATGG - Intergenic
1053542837 9:38993074-38993096 GGTCACAACACTCTGATGGGTGG + Intergenic
1053807283 9:41816591-41816613 GGTCACAACACTCTGATGGGTGG + Intergenic
1054623309 9:67370836-67370858 GGTCACAACACTCTGATGGGTGG - Intergenic
1054965999 9:71027058-71027080 GGTCACAACACTTTGATGGGTGG - Intronic
1055215418 9:73854152-73854174 GCTAACAACACTTTAATGGAAGG - Intergenic
1056572624 9:87828878-87828900 GGTCACAACACTTGTATGGGTGG - Intergenic
1057638479 9:96794825-96794847 GGTCACAACACTCTGATGGGAGG + Intergenic
1060336670 9:122730286-122730308 GGTCACTACACCTCTATGGATGG - Intergenic
1061179045 9:129013324-129013346 GGCCACACCACTGCAATGACAGG + Intronic
1061407610 9:130401121-130401143 GGTCTCAACACTGCAGAGCATGG - Intronic
1062617178 9:137403156-137403178 AGTCCCCACACTGCCATGGAGGG - Intronic
1185846148 X:3440245-3440267 GATCACAACACAGAACTGGACGG - Intergenic
1185853924 X:3515593-3515615 GGTTACAACCCTGCAAAGGAAGG + Intergenic
1185959488 X:4533192-4533214 GGTCAGAAAAGTGCAGTGGAGGG - Intergenic
1188493148 X:30756696-30756718 TGTCACAACACTCTGATGGATGG - Intergenic
1188797100 X:34480927-34480949 GGTCACAACACTTCAATGGGTGG + Intergenic
1188837727 X:34978731-34978753 GGCCACAACACTCCAATGGGTGG - Intergenic
1189327339 X:40120779-40120801 GGTCACAAAATTACCATGGATGG + Intronic
1189558035 X:42165636-42165658 GGTCACAACACTCCAATGGGTGG + Intergenic
1190326731 X:49211128-49211150 GGGCAGAACACTGTCATGGACGG + Intronic
1191816841 X:65254297-65254319 GGCCACAACAGTGCAATGGCTGG - Intergenic
1192766738 X:74147219-74147241 GGTCACAATACTCCAATGGCTGG - Intergenic
1192927894 X:75776014-75776036 GGTTACAACACTCCAATGGGTGG + Intergenic
1193224122 X:78961470-78961492 GGTCACAGAACTGCCATGGCGGG - Exonic
1193401950 X:81055477-81055499 GGCCACAACACTCCCATGGTGGG - Intergenic
1193494701 X:82196957-82196979 GTTCACAATACTGCAATTGGTGG + Intergenic
1193635309 X:83943340-83943362 GGTCAGAACACTTAAATGGGTGG + Intergenic
1193749558 X:85326078-85326100 GGTCACAACACTCCTATGGGTGG + Intronic
1194851528 X:98875815-98875837 GGCCACAAAACTCCAATGCATGG + Intergenic
1195544464 X:106099923-106099945 GGTCACAACACTCCGATGGCTGG + Intergenic
1195586198 X:106567530-106567552 GGTCACGACACTCCAATGGGTGG - Intergenic
1196584177 X:117409876-117409898 GGTCACAGCACTCCAATGGGTGG - Intergenic
1197141567 X:123122546-123122568 GGTCACAACACTCTAATAGGTGG - Intergenic
1197370523 X:125621149-125621171 GGTCACAACATTCCAATAGGTGG + Intergenic
1197570779 X:128147759-128147781 GGTCACAATACTGTAATGGGTGG - Intergenic
1198758902 X:140011168-140011190 AGTCACAACAGTCCAATGGGCGG + Intergenic
1198779842 X:140222413-140222435 AGTCACAACAGTCCAATGGGCGG - Intergenic
1199216606 X:145266360-145266382 GGTCACAATAATCCAATGGGTGG - Intergenic
1199707089 X:150437126-150437148 GGTCACAACACTGCAATGGATGG + Intronic
1199786939 X:151114311-151114333 GTCCACAACACTCCAATGGGTGG + Intergenic
1200809537 Y:7468773-7468795 GGTTACAACCCTGCAAAGGAAGG - Intergenic
1201229134 Y:11846057-11846079 GGGCACTACACTGTGATGGATGG - Intergenic
1201968276 Y:19762536-19762558 GGTCACAACACTCTAATGATTGG + Intergenic