ID: 1199708194

View in Genome Browser
Species Human (GRCh38)
Location X:150449368-150449390
Sequence CACATACGCTGTTACACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199708194_1199708198 -10 Left 1199708194 X:150449368-150449390 CCCTCAGTGTAACAGCGTATGTG 0: 1
1: 0
2: 0
3: 6
4: 182
Right 1199708198 X:150449381-150449403 AGCGTATGTGGACATTTGGATGG 0: 1
1: 0
2: 0
3: 17
4: 350
1199708194_1199708199 5 Left 1199708194 X:150449368-150449390 CCCTCAGTGTAACAGCGTATGTG 0: 1
1: 0
2: 0
3: 6
4: 182
Right 1199708199 X:150449396-150449418 TTGGATGGCTGCAAAAATACTGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199708194 Original CRISPR CACATACGCTGTTACACTGA GGG (reversed) Intronic
901214307 1:7546617-7546639 AAGAAACGCTGTTACACTGTTGG - Intronic
907844540 1:58191810-58191832 CACAGAGGCTGGTACACAGAAGG + Intronic
908907341 1:69030943-69030965 GAAATCCGCTGTTAAACTGATGG - Intergenic
909557358 1:76968942-76968964 GAAATCCACTGTTACACTGATGG + Intronic
910635525 1:89403831-89403853 CAGATCTGCTGTTACTCTGATGG + Intergenic
910717564 1:90248760-90248782 GACATCCGCTGTTAGTCTGATGG - Intergenic
911335320 1:96574458-96574480 AACATGCTCTGTTACACAGAGGG + Intergenic
912646337 1:111395515-111395537 CAGATCCGCTGTTAGTCTGATGG - Intergenic
913040522 1:115018416-115018438 CACATCAGCTGTTAGTCTGATGG + Intergenic
913190090 1:116406113-116406135 CACATACGCTGCTGCGATGAAGG + Intronic
914404797 1:147359744-147359766 CACATCCACTGTTAGTCTGATGG - Intergenic
915753320 1:158233679-158233701 CAGATCCGCTGTTAGTCTGATGG + Intergenic
917914524 1:179688407-179688429 GAGATACGCTGTTAGTCTGATGG + Intronic
918085079 1:181238249-181238271 CCCATAGGCTGCTACACTGAGGG - Intergenic
1066152696 10:32641015-32641037 GAGATCCGCTGTTACTCTGATGG + Intronic
1066785002 10:38993973-38993995 CAGATCCGCTGTTAGTCTGATGG + Intergenic
1067785935 10:49247251-49247273 CAGATCCGCTGTTAGTCTGATGG - Intergenic
1068233942 10:54207799-54207821 TACTTACTCTGTTACACTTAAGG + Intronic
1070094684 10:73325115-73325137 CAGATCCGCTGTTAGTCTGATGG - Intronic
1073022406 10:100456221-100456243 GAGATCCGCTGTTAGACTGATGG - Intergenic
1073215164 10:101832284-101832306 CACACACACAGTAACACTGAGGG - Intronic
1074525272 10:114257666-114257688 CACATACACTGCCACACTGCTGG - Intronic
1075265031 10:120992896-120992918 CACATACATGGTTACACAGATGG - Intergenic
1076036134 10:127199879-127199901 CAGATACACTGGTTCACTGAGGG - Intronic
1078119798 11:8495475-8495497 CAGGAACGCTGTTACACTGTTGG + Intronic
1078681596 11:13481744-13481766 CAGATCCGCTGTTAGTCTGATGG - Intergenic
1079426249 11:20344454-20344476 GACATCTGCTGTTACTCTGATGG - Intergenic
1080363665 11:31545763-31545785 GAGATCCGCTGTTACTCTGATGG - Intronic
1080710237 11:34739557-34739579 GAGATCCGCTGTTACCCTGATGG - Intergenic
1081268758 11:41058587-41058609 CAAATATCCTGTAACACTGATGG + Intronic
1082655787 11:55855690-55855712 CATCTACTCTGTTACTCTGATGG + Intergenic
1082897545 11:58208362-58208384 CACATACGCTTACACACTGTTGG + Intergenic
1083516558 11:63264174-63264196 CACATAAGCACTTACACTGCAGG + Intronic
1083718572 11:64592772-64592794 CACACACGAGGTTCCACTGATGG - Exonic
1086811876 11:91320664-91320686 CAGATCCGCTGTTAGTCTGATGG + Intergenic
1087794437 11:102440328-102440350 GACATCCGCTGTTAGTCTGATGG - Intronic
1093988289 12:25562498-25562520 GACATCCGCTGTTAGTCTGATGG + Intronic
1097531983 12:60812939-60812961 GACATCCGCTGTTAGGCTGATGG + Intergenic
1098726903 12:73979509-73979531 CAGATCCGCTGTTAGTCTGATGG - Intergenic
1099550852 12:84042119-84042141 GACATATGCTGTTAGTCTGATGG + Intergenic
1105667516 13:22576376-22576398 GAGATCCGCTGTTACTCTGATGG - Intergenic
1107325634 13:39239385-39239407 AAGATCCGCTGTTACTCTGATGG + Intergenic
1110459694 13:75731987-75732009 CAGATCCGCTGTTAGTCTGATGG + Intronic
1114374075 14:22124085-22124107 CACATACTCATTTCCACTGATGG - Intergenic
1114695312 14:24622084-24622106 CAGATCCGCTGTTAGTCTGATGG + Intergenic
1118829800 14:69420360-69420382 GAGATACGCTGTTAGTCTGATGG + Intronic
1131362664 15:91806982-91807004 CACAGAAGCTGTTTCACTGCTGG + Intergenic
1132016706 15:98324303-98324325 CACACAGGCTGTTGGACTGAGGG + Intergenic
1135621878 16:23962842-23962864 CACATATACTGTTACAGTGATGG - Intronic
1137503586 16:49030463-49030485 GACATCCGCTGTTAGTCTGATGG - Intergenic
1138926182 16:61593889-61593911 GACATTGGCTGTTACACCGAGGG - Intergenic
1146743034 17:35302932-35302954 CAGATTCGCTGTTAGTCTGATGG - Intergenic
1149527375 17:57367202-57367224 CACAGACGAAGCTACACTGAGGG + Intronic
1150460632 17:65347385-65347407 CAGATGCTGTGTTACACTGAAGG - Intergenic
1153430046 18:5005772-5005794 CAGATCCGCTGTTAGTCTGATGG - Intergenic
1154101356 18:11477798-11477820 GAGATCCGCTGTTACTCTGATGG + Intergenic
1155409295 18:25524628-25524650 CAGAAACGCTTTTACACTGTTGG - Intergenic
1156908188 18:42380110-42380132 CAGATCCGCTGTTAGTCTGATGG + Intergenic
1158676797 18:59527841-59527863 GAGATCCGCTGTTACTCTGATGG + Intronic
1163157502 19:15447535-15447557 CACATACCCTGGCACACCGAAGG + Intronic
925076568 2:1021442-1021464 CAAATACCCTGTTAAAATGATGG - Intronic
926873344 2:17447306-17447328 CACAGACACTGTTAGTCTGATGG - Intergenic
930467497 2:51773403-51773425 CAGATATGCTGTTAGTCTGACGG + Intergenic
930473970 2:51855081-51855103 GAGATCCGCTGTTACTCTGACGG - Intergenic
930893869 2:56422814-56422836 GACATCCGCTGTTAGTCTGATGG - Intergenic
931594685 2:63928292-63928314 GACATCCGCTGTTAGTCTGATGG - Intronic
933018683 2:77163605-77163627 CAGATCCGCTGTTAGTCTGATGG - Intronic
933237231 2:79878430-79878452 CAGGTACGCTTTTACACTGTTGG - Intronic
933507321 2:83194431-83194453 AACATATCCTTTTACACTGATGG - Intergenic
935922803 2:108033588-108033610 CACTTCCACTGGTACACTGAGGG + Intergenic
939239206 2:139537184-139537206 CATATCCGCTGTTAGTCTGATGG + Intergenic
939485831 2:142810632-142810654 CAGATCCGCTGTTAGTCTGATGG + Intergenic
939665643 2:144948022-144948044 GATATAGGCTGTTTCACTGAAGG - Intergenic
940096616 2:149983371-149983393 CAGAAACACTTTTACACTGATGG + Intergenic
940359530 2:152782508-152782530 CACAAAAGCTGTTATACTCATGG - Intergenic
940905422 2:159164965-159164987 CACATACTCTGTTAAAGTGGTGG - Intronic
941453499 2:165688435-165688457 GATATACCCTGTGACACTGAGGG - Exonic
941478230 2:165973540-165973562 GAGATTCGCTGTTACTCTGATGG - Intergenic
943710969 2:191094368-191094390 GAGATACGCTGTTAGTCTGATGG - Intronic
944189398 2:196985155-196985177 CTCATGGGTTGTTACACTGAGGG - Intronic
944363305 2:198884961-198884983 CACATTCTATGTAACACTGAAGG - Intergenic
948737139 2:240016555-240016577 CACATGTGCTGTGACTCTGATGG - Intronic
1169283487 20:4288087-4288109 GAGATACGCTGTTAGTCTGATGG + Intergenic
1172014079 20:31862697-31862719 CACATACGCTGTCACAATCGTGG + Exonic
1176340588 21:5691328-5691350 CAAAAACGCTTTTACACTGTGGG + Intergenic
1176430476 21:6572373-6572395 CACACATGCTGTTACACACAGGG - Intergenic
1176451164 21:6862603-6862625 GACATCCGCTGTTAGTCTGATGG - Intergenic
1176472842 21:7123481-7123503 CAAAAACGCTTTTACACTGTGGG + Intergenic
1176504239 21:7633128-7633150 CAAAAACGCTTTTACACTGTGGG - Intergenic
1176829333 21:13727654-13727676 GACATCCGCTGTTAGTCTGATGG - Intergenic
1178168459 21:30009782-30009804 TACATACTCTGTTACATTAAAGG + Intergenic
1178218878 21:30632420-30632442 TACATACACTGTTAAATTGATGG + Intergenic
1179508051 21:41854866-41854888 CCCACACGCTGATACACAGATGG - Intronic
1179705870 21:43179835-43179857 CACACATGCTGTTACACACAGGG - Intergenic
1185041295 22:48505791-48505813 CAGAAAAGCTGTTACACTCATGG + Intronic
1203239851 22_KI270733v1_random:5786-5808 CAAAAACGCTTTTACACTGTGGG + Intergenic
949193638 3:1280324-1280346 CACGGGCGCTGTTACAATGAGGG - Intronic
950176493 3:10878316-10878338 CACATATGCTGTTTCTCTGCTGG + Intronic
952513841 3:34084074-34084096 GACATCCGCTGTTAGTCTGATGG + Intergenic
952751966 3:36831921-36831943 CACATAGTCTATTTCACTGAAGG + Exonic
957282881 3:78176338-78176360 GTCATATGCTGTGACACTGAGGG - Intergenic
958961191 3:100511252-100511274 GACATCCGCTGTTAGTCTGATGG - Intronic
960607204 3:119518795-119518817 CAAATCTGCTGTTAAACTGATGG - Intronic
960828065 3:121813048-121813070 GACATCCGCTGTTAGTCTGATGG - Intronic
961720224 3:128889471-128889493 CACTTCCTCTGTTGCACTGATGG - Intronic
962019790 3:131486830-131486852 TACAAACGCTTTTACACTGTTGG + Intronic
962442866 3:135439058-135439080 GAGATCCGCTGTTACTCTGATGG - Intergenic
969841300 4:9884525-9884547 CAAATACACTGTTGCACAGATGG - Intronic
970643405 4:18091998-18092020 CAGATCCGCTGTTAGTCTGACGG - Intergenic
971989262 4:33869723-33869745 CAGAAATGCTTTTACACTGATGG + Intergenic
973084294 4:46035710-46035732 CACATACTCTGAAACAGTGAAGG + Intergenic
973544936 4:51972089-51972111 CAGATCCGCTGTTAGTCTGATGG + Intergenic
973682068 4:53330374-53330396 GAGATACGCTGTTAGTCTGATGG - Intronic
973914645 4:55620794-55620816 GAGATACGCTGTTAGTCTGATGG - Intronic
977506072 4:97905235-97905257 GACATCCGCTGTTAGTCTGATGG - Intronic
980231360 4:130050563-130050585 GACATCCGCTGTTAGTCTGATGG + Intergenic
980507128 4:133738300-133738322 GAGATCCGCTGTTACTCTGATGG + Intergenic
987255227 5:16143532-16143554 CAGATTAGCTGTTACACTAATGG - Intronic
988257929 5:28845715-28845737 GACATCCGCTGTTAGTCTGATGG - Intergenic
988746132 5:34140713-34140735 CACATTCGCTGATACCCTGCGGG - Intergenic
988859237 5:35260322-35260344 GACATACGCTGTTAGTCTGATGG + Intergenic
988984504 5:36603702-36603724 CACATCCACTGTTACACTCTGGG + Intergenic
992854020 5:80841518-80841540 CAGAAACGCTTTTACACTGTTGG - Intronic
996607462 5:125340988-125341010 CACATAGGGAGCTACACTGAAGG - Intergenic
997861510 5:137422160-137422182 GAGATACGCTGTTAGTCTGATGG + Intronic
998685212 5:144516907-144516929 GACATCCGCTGTTAGTCTGATGG + Intergenic
999058843 5:148611306-148611328 CAGATCCGCTGTTAGTCTGATGG - Intronic
1001770422 5:174292019-174292041 CACTTAGGCTGTTGGACTGAGGG + Intergenic
1002110123 5:176903090-176903112 CACAAATGATGTTGCACTGAGGG - Intergenic
1002370566 5:178749943-178749965 CACTTACTCTGTTTCACTAACGG + Intergenic
1002673398 5:180889060-180889082 CAGATCCGCTGTTAGTCTGATGG - Intergenic
1003971177 6:11300642-11300664 CAGATCCGCTGTTAGTCTGATGG - Intronic
1008574733 6:52849224-52849246 CACATTCCCTGTTTCACTGAGGG + Intronic
1009239009 6:61161919-61161941 AAGATACGCTGTTAGTCTGATGG + Intergenic
1009453772 6:63830845-63830867 GAAATCCGCTGTTACTCTGATGG - Intronic
1011348209 6:86394354-86394376 GACATCCGCTGTTAGTCTGATGG - Intergenic
1011533696 6:88352588-88352610 GACATCCGCTGTTAGTCTGATGG - Intergenic
1011772073 6:90684435-90684457 CACATATGCTGTCAAACTGCTGG + Intergenic
1014643772 6:123947854-123947876 CACATACACAGTTAGACAGAAGG - Intronic
1020869009 7:13604433-13604455 CACATAGGCTGTGGTACTGAGGG + Intergenic
1021374352 7:19888326-19888348 GAGATACGCTGTTAGTCTGATGG + Intergenic
1022556181 7:31299568-31299590 CTCATAGGCTGTTGGACTGAGGG - Intergenic
1023049788 7:36241060-36241082 CACATACCCCTTTACACAGAAGG - Intronic
1023192448 7:37597180-37597202 CTCATACGCTCATACGCTGATGG - Intergenic
1024206020 7:47161430-47161452 GAGATCCGCTGTTAGACTGATGG - Intergenic
1024717916 7:52101585-52101607 GAGATCCGCTGTTACTCTGATGG + Intergenic
1026068490 7:67096838-67096860 CGCATTCTCTGTTAGACTGAAGG + Intronic
1026708423 7:72715474-72715496 CACATTCTCTGTTAGACTGAAGG - Intronic
1026889174 7:73972188-73972210 CACATCGACTGTTACACTGGGGG + Intergenic
1027451971 7:78342336-78342358 AACAAACGCTTTTACACTGTTGG + Intronic
1028327205 7:89541748-89541770 GAGATCCGCTGTTACACTGATGG - Intergenic
1029902878 7:104060563-104060585 GAGATACGCTGTTAGTCTGATGG - Intergenic
1032798303 7:135296812-135296834 TACAAACGCTTTTACACTGTTGG + Intergenic
1036022015 8:4856043-4856065 GAGATCCGCTGTTACTCTGATGG - Intronic
1036128907 8:6090135-6090157 GAGATCCGCTGTTACTCTGATGG + Intergenic
1040403571 8:47077277-47077299 GAGATCCGCTGTTAGACTGATGG - Intergenic
1041743267 8:61178626-61178648 CAGATCTGCTGTTACTCTGATGG - Intronic
1045157295 8:99491223-99491245 GACATCCGCTGTTAGTCTGATGG + Intronic
1048156666 8:131961838-131961860 GAGATCCGCTGTTACTCTGATGG - Intronic
1048834595 8:138506429-138506451 CACCTACTCTATTACACAGAGGG - Intergenic
1051014870 9:12462369-12462391 CACATTAGCTTTTACTCTGAAGG + Intergenic
1051309302 9:15752281-15752303 TAGGTACGCTGTTACACTGTTGG + Intronic
1055422047 9:76153899-76153921 CACATCTACTGTTACCCTGAGGG - Intronic
1060615805 9:125011810-125011832 GACATCCGCTGTTAGTCTGATGG - Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1061632161 9:131879272-131879294 CCCCTACCCTGTCACACTGAAGG + Intronic
1203422479 Un_GL000195v1:6665-6687 CAAAAACGCTTTTACACTGTGGG - Intergenic
1203518017 Un_GL000213v1:21914-21936 GACATCCGCTGTTAGTCTGATGG + Intergenic
1186605168 X:11081982-11082004 CACTCACGCTGTTAGAGTGAGGG + Intergenic
1189598136 X:42591426-42591448 GAGATACGCTGTTAGTCTGATGG - Intergenic
1192774126 X:74223926-74223948 AACATAACCAGTTACACTGAAGG + Intergenic
1192915870 X:75650811-75650833 CACATCCACTGTTAGTCTGATGG + Intergenic
1192918873 X:75684750-75684772 TAGATCCGCTGTTACTCTGATGG + Intergenic
1192942465 X:75926780-75926802 GACATCCGCTGTTAGTCTGATGG - Intergenic
1193341127 X:80351005-80351027 GAGATACGCTGTTAGTCTGATGG + Intronic
1193793058 X:85840467-85840489 CACATCTGCTGTTACAGTCATGG + Intergenic
1194228998 X:91298916-91298938 GACATCCGCTGTTAGTCTGATGG + Intergenic
1194609254 X:96020695-96020717 GAGATCCGCTGTTACTCTGATGG + Intergenic
1195126938 X:101817197-101817219 CACAAATGCTTTTACACTGTTGG - Intergenic
1196583399 X:117401539-117401561 GACATCTGCTGTTAAACTGATGG - Intergenic
1199450081 X:147969205-147969227 GACATCCGCTGTTAGTCTGATGG - Intergenic
1199708194 X:150449368-150449390 CACATACGCTGTTACACTGAGGG - Intronic
1200331561 X:155303943-155303965 CAGATCCGCTGTTAGTCTGATGG + Intronic
1200353125 X:155520384-155520406 CAGATCCGCTGTTAGTCTGATGG + Intronic
1200803493 Y:7408458-7408480 CAGATCTGCTGTTAGACTGATGG - Intergenic
1201392001 Y:13508766-13508788 CACACACACTTTTACACTGCTGG + Intergenic
1201392958 Y:13518659-13518681 CAGATGCGCTGTTAGTCTGATGG + Intergenic
1201664039 Y:16428767-16428789 GAGATCCGCTGTTACTCTGATGG - Intergenic
1201967289 Y:19752340-19752362 GAGATCCGCTGTTACTCTGATGG + Intergenic