ID: 1199712583

View in Genome Browser
Species Human (GRCh38)
Location X:150480795-150480817
Sequence ATATAGTCCTGGGCTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199712579_1199712583 -9 Left 1199712579 X:150480781-150480803 CCAGGACATTATATATATAGTCC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1199712583 X:150480795-150480817 ATATAGTCCTGGGCTAAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199712583 Original CRISPR ATATAGTCCTGGGCTAAAGG TGG Intronic
904577452 1:31514206-31514228 ACAGAGTCCTGGGCAGAAGGGGG - Intergenic
905111174 1:35595609-35595631 ATCCAGGCCTGGGCTAAAGAAGG - Intergenic
906591899 1:47032665-47032687 TCATAGACCTGGGCTCAAGGAGG + Intronic
907028997 1:51152369-51152391 GTATAGTTCTTGGCTAAAGCTGG - Intergenic
907761506 1:57366095-57366117 ATATTGTCCTTGGCTAAAGCTGG - Intronic
907880190 1:58542377-58542399 ATATAGTCCTGCTCTCATGGAGG + Intronic
912530353 1:110316364-110316386 GCATAGTCCTGGGGTAAAGAGGG + Intergenic
912759152 1:112351166-112351188 ATATAGTCCAGGGATCAAGCAGG - Intergenic
916247731 1:162705483-162705505 GTATGTGCCTGGGCTAAAGGGGG + Intronic
918270760 1:182896589-182896611 AGATAGTCCTGGGCCAATTGAGG - Intergenic
923179398 1:231501472-231501494 ATAGAGTTCTGGGGGAAAGGAGG - Intergenic
923625689 1:235612169-235612191 ACGTTGTCCTGGGCTAAAGAGGG - Intronic
924501791 1:244645053-244645075 CGATAGTCCTGGGCTGTAGGTGG + Intergenic
1063502396 10:6566972-6566994 ATATATTCCCTGGCTACAGGAGG + Intronic
1063954883 10:11256524-11256546 AGAGTGTCCTGGGCTAGAGGAGG - Intronic
1072095342 10:92172762-92172784 AAATAGTCCTGGGGTAAAGTTGG + Intronic
1075586214 10:123660092-123660114 ATGAAGTCCTGGGCTGAGGGAGG + Intergenic
1078797802 11:14610662-14610684 AAATAGTCATGGGACAAAGGAGG - Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1085336934 11:75703517-75703539 ACATGGTCCTGGGCTGAATGTGG - Intergenic
1087827356 11:102781015-102781037 ATATAGTCGTGGTCTAAATGTGG + Intergenic
1094322822 12:29204248-29204270 ACATAGTCCTGGTTTAGAGGAGG - Intronic
1095971724 12:47906023-47906045 ATATCTTCCCTGGCTAAAGGAGG - Intronic
1107197055 13:37665371-37665393 ATATAGTCCTGAGCTATATTAGG - Intronic
1107513545 13:41107727-41107749 ATAGAGTCCTGGGCGGAAGGGGG + Intergenic
1109613716 13:64802167-64802189 ATGTCGTCCTGGGCTAAGGTTGG - Intergenic
1112185488 13:97124362-97124384 ATCTAGGCCTGGGCTATTGGGGG - Intergenic
1116257778 14:42579309-42579331 ATATAGTCCTTTGCTTCAGGAGG + Intergenic
1118907271 14:70031988-70032010 ATGGGGTCTTGGGCTAAAGGAGG + Intronic
1119847143 14:77839126-77839148 ATGTAGTCATGGGATAAAGAGGG + Intronic
1127600551 15:60531997-60532019 ATTTAGTCCAGGGCTCTAGGGGG - Intronic
1127832469 15:62763133-62763155 ACAAAGTCCTGGGCTACAGTAGG - Intronic
1128072612 15:64807162-64807184 ATATATGCTTTGGCTAAAGGAGG - Intergenic
1128212584 15:65912982-65913004 CTATAGTCCTGGGCTATGTGAGG - Intronic
1128682890 15:69664425-69664447 ATAGACTCCTGGGCTTGAGGAGG - Intergenic
1131757876 15:95585739-95585761 ATATCATCCTGGGTTAAAGATGG - Intergenic
1135825662 16:25725498-25725520 ATATATCACTGGGTTAAAGGGGG - Intronic
1140315444 16:73891863-73891885 ATGAAGTCCAGGGCTACAGGGGG + Intergenic
1144058941 17:11564574-11564596 AAATAGTTCTGGGCTAAATGAGG - Intergenic
1146043861 17:29485551-29485573 TCAAACTCCTGGGCTAAAGGGGG - Intronic
1149566217 17:57642537-57642559 AGCTGGGCCTGGGCTAAAGGAGG - Intronic
1153161641 18:2211915-2211937 TTCAAGTCATGGGCTAAAGGAGG - Intergenic
1155779401 18:29811867-29811889 AGGTATTCCTGGTCTAAAGGGGG - Intergenic
1158758089 18:60350464-60350486 CTTTAGTCCTGGGATAAAGCTGG + Intergenic
1158773814 18:60553162-60553184 ACAGAGTCCTGGGCAGAAGGGGG + Intergenic
1159136770 18:64346049-64346071 ATATCATCTTAGGCTAAAGGTGG - Intergenic
1167350275 19:48969848-48969870 ATATAGTACTAGGGGAAAGGAGG + Exonic
928007339 2:27575105-27575127 ATATAATCCTGGGGCAAAGTTGG + Intergenic
933383691 2:81583568-81583590 ATTTATTCCTGGGCAGAAGGTGG + Intergenic
937120321 2:119436344-119436366 CTAGAGTCCTGGGCTGAACGTGG + Intronic
937660187 2:124421870-124421892 ATATAATCATGGGCTAATGGTGG - Intronic
940640071 2:156334948-156334970 ATATAGTCCTAGGAAAACGGGGG + Intronic
943988895 2:194660318-194660340 AAATAGTCCTGAGCAAAAGCTGG + Intergenic
946646120 2:221836255-221836277 ACATTGTTCTGGGCTCAAGGTGG + Intergenic
1169707588 20:8523130-8523152 ATATAATCCTTGGACAAAGGGGG + Intronic
1170018424 20:11809189-11809211 ATCTAGTCCTGAGCTTAAGTGGG + Intergenic
1171006684 20:21472939-21472961 TTATACTCCTGGTCTGAAGGAGG - Intergenic
1179225787 21:39451873-39451895 AAATATTCCTGGGCCAATGGAGG + Exonic
1182499084 22:30732581-30732603 ATCTAGTCCTGGGGTAAGGGAGG - Intronic
964432003 3:156617128-156617150 AAATAGTCCTGGGCTAGAGTAGG - Intergenic
964791839 3:160460321-160460343 ACAGATTCCTGGGCTGAAGGGGG - Intronic
967482503 3:189989828-189989850 ATAGAGTCCAGAGCCAAAGGTGG - Intronic
968869109 4:3232376-3232398 CCATAGTCTTGGGCTGAAGGAGG + Intronic
975858106 4:78646421-78646443 TTTCAGTCCTGGGCCAAAGGGGG + Intergenic
976347053 4:84016174-84016196 AGAAAGTCCTGGGCAAAATGGGG - Intergenic
979448226 4:120839715-120839737 ATAGGCTCCTGGGCAAAAGGGGG - Intronic
987652726 5:20764727-20764749 ATATAAACCTGGGTTAATGGAGG - Intergenic
988742833 5:34096757-34096779 ATATAAACCTGGGTTAATGGAGG + Intronic
996891698 5:128428364-128428386 ATGTAGTCCAGGGCCAAATGGGG - Intronic
998157404 5:139794921-139794943 TTAGAGTCCTGGGCTGAGGGGGG + Intergenic
998942628 5:147301148-147301170 AGAAAGTCCTGGGGCAAAGGTGG + Intronic
1000742233 5:164983585-164983607 ATGTGGCCCTGTGCTAAAGGTGG - Intergenic
1003395129 6:5746570-5746592 ATATTGTCCTGGCCTCCAGGTGG + Intronic
1003629533 6:7774042-7774064 GTATAGTCCTGGGCCAAGGTGGG + Intronic
1004500728 6:16207761-16207783 ATTTAGTAGTGGGCTAAGGGAGG - Intergenic
1004671010 6:17796813-17796835 ACATAGTCCTGGGATAAGTGGGG + Exonic
1005021484 6:21423378-21423400 ATTGATTCCTGGGCGAAAGGGGG - Intergenic
1005030271 6:21501967-21501989 GTATAGTCCAAGGCTAAAAGCGG + Intergenic
1008495749 6:52132464-52132486 ATATAGGATTGGGCTAAAGCAGG - Intergenic
1012425638 6:99111426-99111448 AAAAAGTCCTGGTCTAAATGTGG + Intergenic
1012877996 6:104752372-104752394 ATATAGTCATGTGCTAATGCAGG - Intronic
1013236080 6:108198829-108198851 ACAGAGTCCTGGCCTGAAGGGGG - Intergenic
1016406654 6:143738431-143738453 CTATTGCCCTGGGGTAAAGGTGG - Intronic
1017468874 6:154720286-154720308 ATAGTCTCCTGGGGTAAAGGGGG - Intergenic
1018781733 6:167074054-167074076 ACATAGTCCTTGGGTAAAAGAGG + Intergenic
1022692328 7:32669115-32669137 AGCTAGTCCTGGGATAAATGTGG - Intergenic
1031758186 7:125673962-125673984 ATATAGTCCTGCACGAGAGGCGG + Intergenic
1032067656 7:128783647-128783669 ATATAGGCCATGGCTAATGGGGG - Intergenic
1032121773 7:129162150-129162172 CTTTATTCCTGGGCTTAAGGAGG - Intronic
1033720005 7:144049250-144049272 ACAGTTTCCTGGGCTAAAGGTGG + Intergenic
1035252419 7:157605950-157605972 AGAGATTCCTGGGCAAAAGGGGG - Intronic
1042092100 8:65169654-65169676 ATTTAATCATGGGTTAAAGGGGG + Intergenic
1042396033 8:68292811-68292833 ACAGAGTCCTGGGATGAAGGGGG + Intergenic
1042872413 8:73410829-73410851 TTATGGTGCTGGGTTAAAGGTGG - Intergenic
1047145011 8:122188645-122188667 ATGTAGTTTTGAGCTAAAGGAGG + Intergenic
1047666763 8:127100312-127100334 ACATAGTCCTGGGCTGAATAGGG - Intergenic
1047846244 8:128808500-128808522 TAGTAGTCCTGGGATAAAGGTGG - Intergenic
1048577488 8:135704658-135704680 ATCTGGCCCTGGGCTAAGGGGGG - Intergenic
1050105557 9:2162865-2162887 ATATTGTCCTCGGATAGAGGAGG + Intronic
1050666871 9:7948007-7948029 ATATTTTCCTTGGCTAAAGGTGG + Intergenic
1052641664 9:31175310-31175332 ACATAGTTCTTGTCTAAAGGTGG + Intergenic
1053584495 9:39442588-39442610 ATATGGTCCTCGTCTAAAGGTGG + Intergenic
1054106075 9:61001334-61001356 ATATGGTCCTCGTCTAAAGGTGG + Intergenic
1056272532 9:84960361-84960383 ATATAGTCCTGAGCCACAGAAGG + Intronic
1057015433 9:91646986-91647008 GTATAGTCTTGGGCTCAAGGTGG + Intronic
1058561072 9:106229728-106229750 TTATACTCCTGGGCTAATGATGG - Intergenic
1058764883 9:108172456-108172478 AAATAATCCTGGGCAAAAAGTGG - Intergenic
1059543983 9:115158076-115158098 ATGTAGTCCTTGGCAAAGGGTGG + Intronic
1060607694 9:124931736-124931758 GTAAAGTCCTGGGATAAAGAAGG + Intronic
1062207021 9:135342910-135342932 AACTAGTCCTGGCCTAAACGTGG - Intergenic
1062514270 9:136924613-136924635 CTGGAGTCCTGGGCTAAAGCTGG - Intronic
1185930447 X:4197042-4197064 ATACACTCCTGGGATAAATGTGG - Intergenic
1189360166 X:40343881-40343903 ACAGAGTCCTGGGCAGAAGGGGG + Intergenic
1189645990 X:43132520-43132542 ATATTGTGCTGGGCTAGAGTAGG - Intergenic
1194844669 X:98790138-98790160 ATGTAGTCCTGGGTTAGATGGGG - Intergenic
1198005211 X:132486945-132486967 ATATAGTGCTGGGCTAGAGGTGG - Intronic
1199712583 X:150480795-150480817 ATATAGTCCTGGGCTAAAGGTGG + Intronic