ID: 1199716338

View in Genome Browser
Species Human (GRCh38)
Location X:150509567-150509589
Sequence CAGAGTATGTAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199716338_1199716343 17 Left 1199716338 X:150509567-150509589 CCTCCCTCCTTCTACATACTCTG 0: 1
1: 0
2: 1
3: 22
4: 292
Right 1199716343 X:150509607-150509629 TAATGTTACATTTGTTCTTTTGG 0: 1
1: 2
2: 3
3: 46
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199716338 Original CRISPR CAGAGTATGTAGAAGGAGGG AGG (reversed) Intronic
902676442 1:18011879-18011901 CAGAGTAGGTAGCATGTGGGAGG - Intergenic
902944899 1:19828156-19828178 AAGAGTATGGAGATGGATGGTGG - Intergenic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
905320427 1:37112690-37112712 CAGAGTACATAGAAAGAGGGAGG + Intergenic
905848999 1:41258900-41258922 GAGAATATGTAAAGGGAGGGAGG + Intergenic
905909843 1:41646240-41646262 CAGCCTATGGAGAAGGAAGGAGG + Intronic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
906259669 1:44377539-44377561 CAGAGTACGGAGAGAGAGGGAGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911218905 1:95226189-95226211 CAGATTATGTTGAAGGGGGCAGG - Intronic
911406665 1:97449346-97449368 CAGAGAATTGAGGAGGAGGGAGG + Intronic
911766283 1:101679018-101679040 AAGAGTATGTAAGAGGATGGGGG - Intergenic
914838008 1:151224062-151224084 GTGAGTATGGAGAAGGAGAGAGG + Intronic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915930979 1:160060928-160060950 CAGAGTTCGTAGCAGGAGTGGGG + Intronic
916243365 1:162661660-162661682 CGGAGGTTGTAGGAGGAGGGAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918526934 1:185474918-185474940 CAGATTATGCTGCAGGAGGGAGG - Intergenic
920267732 1:204736926-204736948 CAGAGTACGTACAAGGCGAGTGG + Intergenic
920449398 1:206047806-206047828 CCTAGGATGCAGAAGGAGGGAGG - Intronic
921784383 1:219211168-219211190 CACACAATGTGGAAGGAGGGAGG - Intronic
922814622 1:228439746-228439768 ACGAGTAGGTAAAAGGAGGGTGG - Intergenic
923663588 1:235979629-235979651 AGGAGCATGAAGAAGGAGGGAGG - Intronic
924070619 1:240274633-240274655 CAGAATATCAAGAAGAAGGGAGG + Intronic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1064233065 10:13547005-13547027 AAGAGACTGTAGAAGGAGTGGGG + Intergenic
1064300345 10:14117657-14117679 GAGAGAAGGTGGAAGGAGGGTGG + Intronic
1064859957 10:19816208-19816230 CAAAGTGTGGAGAAGGAGCGCGG + Intergenic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065234369 10:23633519-23633541 CAGAGGATGTAGATGGGAGGGGG - Intergenic
1066295041 10:34046710-34046732 CAGAGGATGTACAGGGAGTGTGG + Intergenic
1067664818 10:48268679-48268701 CAGAGATAGTAGAAGCAGGGTGG + Intronic
1068303228 10:55173347-55173369 ATGTGTATGTAGAAGGATGGGGG + Intronic
1068725727 10:60300500-60300522 TAGAGTATTTAAATGGAGGGTGG + Intronic
1069679665 10:70274937-70274959 CAGAGGATCTAGGAGGAAGGAGG + Intronic
1071384309 10:85104231-85104253 CAGAGGATGGAGCAGCAGGGAGG - Intergenic
1073026309 10:100489579-100489601 AAGAGTAAGTGGGAGGAGGGCGG + Intronic
1073876535 10:107929145-107929167 CAGTGTATGTAAAAAGAGTGAGG - Intergenic
1073899035 10:108197799-108197821 CAGTGAATGTAGAGGGAGAGAGG + Intergenic
1074432251 10:113404045-113404067 CAAAGTAGGTAGAAGGTGTGGGG - Intergenic
1074548135 10:114417842-114417864 CAAAATACGTAGGAGGAGGGAGG + Intergenic
1074938704 10:118213720-118213742 AAGAGTTTGGAGAAGGAGGGAGG + Intergenic
1074987195 10:118668939-118668961 CAGATGAGGAAGAAGGAGGGTGG + Intergenic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1077093779 11:790897-790919 CAGAGGCTGAAAAAGGAGGGTGG + Exonic
1077345368 11:2046537-2046559 CAGAGTATAAAAATGGAGGGTGG - Intergenic
1077392564 11:2306887-2306909 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1078199486 11:9167355-9167377 CAGAATATTTTGGAGGAGGGTGG - Intronic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1080221842 11:29914861-29914883 GAGAGTATGTAGCAGGTGGTGGG - Intergenic
1084040788 11:66541583-66541605 CAAAGTGTGTAGAGTGAGGGGGG + Intronic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086693537 11:89817038-89817060 CAGGGTCAGTAGTAGGAGGGAGG - Intergenic
1086712611 11:90027531-90027553 CAGGGTCGGTAGTAGGAGGGAGG + Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1088422548 11:109665505-109665527 CAAAGGATATAGAAGGAGTGGGG - Intergenic
1089843358 11:121438443-121438465 GTGAGAATGTAGAGGGAGGGTGG - Intergenic
1089860950 11:121589628-121589650 CACATTATGTATAAGGAAGGTGG + Intronic
1089950780 11:122524190-122524212 CAGAGCATGTAGGAGTTGGGGGG - Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090776983 11:129974486-129974508 CAGAATAAGTAGAAGGTGAGGGG + Intronic
1091889100 12:4038942-4038964 CAGAGCATGTTGCAAGAGGGTGG + Intergenic
1092743827 12:11654637-11654659 AAGAGGAAGTAGTAGGAGGGAGG + Intronic
1092892428 12:12981186-12981208 CAGGGTGGGTAGGAGGAGGGAGG + Intronic
1095154897 12:38840846-38840868 AAGAGTTTGTAGAAGTAGAGAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096750050 12:53752763-53752785 CTGAGTGTGTACAAGAAGGGAGG + Intergenic
1097625745 12:61998145-61998167 CAGAGCAAGTAAAAGGAGAGTGG + Intronic
1098580042 12:72088827-72088849 AAGAGAAGGTAGAAGAAGGGAGG - Intronic
1098595535 12:72270799-72270821 CAGAGTATGTATAAGTATGTGGG - Intronic
1098619544 12:72577516-72577538 CAGAGGATATAGAAGGACTGAGG + Intronic
1099910484 12:88826788-88826810 CAGATTATGTGGAAAGAGGTTGG + Intergenic
1100001044 12:89835544-89835566 CAGAGCTTGAAGAAGGAGGCAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1104243948 12:127018766-127018788 CAGAGAAAGTGGATGGAGGGAGG - Intergenic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107406629 13:40120465-40120487 CAAAGAATGTAGAAACAGGGAGG + Intergenic
1107417678 13:40216550-40216572 CAGGGGGTGTAGATGGAGGGAGG - Intergenic
1111286254 13:86096473-86096495 CAGATGATGTAGAAAAAGGGCGG - Intergenic
1113944431 13:114035900-114035922 CAGAGGCTGTAGCAGGAGGCTGG + Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114143145 14:19940541-19940563 CAGAGTTTCTAAAAGGAGTGTGG + Intergenic
1115061547 14:29197090-29197112 AAAAATATGTAGAAGAAGGGAGG + Intergenic
1115995573 14:39192444-39192466 CAGTGTGTGTAGGAAGAGGGAGG + Intergenic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117288175 14:54307566-54307588 CAGAGCATCTAAAAGGAGAGTGG + Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118969407 14:70620564-70620586 CTTAGTATGTAGAAGAAGAGAGG + Intergenic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120205936 14:81587820-81587842 CGAATTATGTAGAAGGAGGAGGG - Intergenic
1120217797 14:81699035-81699057 CTGTGTATGTAGGAGAAGGGTGG - Intergenic
1120337878 14:83181234-83181256 CAGACTATGTGGAAACAGGGTGG + Intergenic
1120751697 14:88203904-88203926 CAGGGTAGGTAGCAGGTGGGAGG + Intronic
1121380675 14:93463175-93463197 GAGAGTTTCAAGAAGGAGGGAGG + Intronic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1122617344 14:103028693-103028715 CACAGAATATAGAAGGAGGCAGG - Intronic
1123221392 14:106860059-106860081 CTGAGTATCTAGAAGTAGAGGGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125858832 15:42978367-42978389 CAGAGTAGGTAAAATGAGGATGG + Intronic
1126450198 15:48799407-48799429 CAGAGTATGTTGGAGGTGGGTGG + Intronic
1128565054 15:68695575-68695597 AAGAATATGAACAAGGAGGGAGG + Intronic
1130579567 15:85123940-85123962 CACAGAATGGAGAAGAAGGGAGG - Intronic
1131141443 15:89979787-89979809 CAGACTATCTAGAAGTATGGGGG + Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1132114044 15:99123000-99123022 TGGAGGATGTAGAAGGAGGTGGG + Intronic
1133686980 16:8174771-8174793 TCAAGTATGTAGAAGGAGGATGG - Intergenic
1134661354 16:15986876-15986898 TAGAGAATGTGGAAGGAGGCCGG + Intronic
1135765898 16:25177860-25177882 CATTTTATGTAGCAGGAGGGCGG + Intronic
1136890827 16:33971391-33971413 AAGAGAATCTAGAAGGTGGGTGG - Intergenic
1137627130 16:49916307-49916329 CAGAGTGGGAACAAGGAGGGTGG - Intergenic
1139239514 16:65376611-65376633 CAGAGTCTAAAGAAAGAGGGAGG + Intergenic
1140543488 16:75783174-75783196 CAGAGGCTGTGGGAGGAGGGTGG - Intergenic
1141238949 16:82246743-82246765 CAGAGAATGTAGAATGGAGGAGG + Intergenic
1203082206 16_KI270728v1_random:1152215-1152237 AAGAGAATCTAGAAGGTGGGTGG + Intergenic
1142644220 17:1301655-1301677 ACAAGTCTGTAGAAGGAGGGAGG + Intergenic
1145995729 17:29103747-29103769 CAGACTGTCTAGGAGGAGGGAGG - Intronic
1147141620 17:38463602-38463624 CAGGGTATCTGGAAGGAGGGTGG + Intronic
1147976981 17:44253426-44253448 CCAAGTATGGAGAAGGAAGGAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1151362968 17:73599628-73599650 GAAAGGATGAAGAAGGAGGGAGG + Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152320636 17:79607325-79607347 CAGAGTATCAAGCAGGAGCGTGG + Intergenic
1152598424 17:81249416-81249438 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152598447 17:81249488-81249510 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152993513 18:384655-384677 GAGATTCTGTAGAAGGAGGTCGG + Intronic
1153718131 18:7871741-7871763 CAGTGAATGTTGAACGAGGGAGG + Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1154404578 18:14077436-14077458 CAGAGTGTGTGGGAGGAGGCAGG + Intronic
1155866461 18:30972262-30972284 CCTAGTATGTTAAAGGAGGGTGG - Intergenic
1158788414 18:60744030-60744052 GAGAGAATGTAAAAGGAGTGAGG - Intergenic
1160349761 18:78166713-78166735 CAGTATATGTAGATGGAGAGGGG + Intergenic
1162501992 19:11059465-11059487 GAGATTGTGCAGAAGGAGGGAGG + Intronic
1164141873 19:22477089-22477111 CAAAGTATTTAGAAGAAAGGGGG - Intronic
1164790248 19:30971453-30971475 GAGAGTCTGGAGAAGGAGGTGGG - Intergenic
926075797 2:9941930-9941952 CAGTGACTGTCGAAGGAGGGCGG - Intergenic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926714285 2:15911823-15911845 CATAGTATTTAGACTGAGGGAGG + Intergenic
926763612 2:16302985-16303007 CATAGCATCTAGAATGAGGGAGG - Intergenic
927282517 2:21321861-21321883 CAGAGGATGGAGAGGCAGGGTGG - Intergenic
928902018 2:36329664-36329686 CAGAAGATGTAGAAGGACAGGGG - Intergenic
929278588 2:40052835-40052857 CAGATTATGTAGAAGTGGGGAGG + Intergenic
929282818 2:40100954-40100976 CAAAGTATGTAAAAGGAGGCTGG - Intronic
930234345 2:48874591-48874613 CATAGTTTGTAGAAGGAAGGAGG + Intergenic
932424438 2:71620172-71620194 CAGATTTTGGAGAGGGAGGGAGG + Intronic
932924895 2:75961757-75961779 CAGAGTGTGTGAAAGGAGTGGGG - Intergenic
933417879 2:82010319-82010341 CAAAGGATGTATAAGGAGGCAGG - Intergenic
934562189 2:95319194-95319216 CAGAGTCTGCAGGAGGAAGGCGG + Intronic
935108102 2:100064365-100064387 CAGATTATGTGGGAGGAGGTAGG - Intronic
943132580 2:183872967-183872989 AAAATTATGTAGAAGGAGGAAGG - Intergenic
943686950 2:190828665-190828687 CAGAGTTTGTAGTAGCATGGAGG - Intergenic
945152098 2:206802590-206802612 CAGTGTATGGAGAGGAAGGGTGG + Intergenic
946254892 2:218435221-218435243 CAGTGAATGTAGTAGGAGGGTGG + Intronic
946416166 2:219540807-219540829 CAGAGAATGTAGAAACAGGCAGG + Intronic
946484277 2:220085953-220085975 CAGGGTCTGTAGCAGGCGGGGGG + Intergenic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948684518 2:239661929-239661951 CAGTGTATCAGGAAGGAGGGCGG - Intergenic
1169100717 20:2946197-2946219 AAAAGTATGTGGGAGGAGGGAGG + Intronic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1171209429 20:23305337-23305359 CACAGTTTGTGGAAGGAGGCAGG - Intergenic
1171287572 20:23954373-23954395 CAGAGCATGCAGGAGGAGAGTGG - Intergenic
1171333810 20:24364869-24364891 CAGAATATGAAGAAGGACAGTGG - Intergenic
1171385431 20:24766597-24766619 TAGAATTTGTACAAGGAGGGAGG - Intergenic
1171486390 20:25489460-25489482 GGGAGTAAGGAGAAGGAGGGGGG - Intronic
1172113935 20:32562921-32562943 GAGAGAGTGGAGAAGGAGGGTGG + Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172778607 20:37422768-37422790 CAGAGGAGGAAGGAGGAGGGAGG - Intergenic
1173540172 20:43845109-43845131 CAGAGGATGACTAAGGAGGGTGG - Intergenic
1173896924 20:46558290-46558312 CAGAGTATGTAGCTGGAGAGGGG + Exonic
1174103103 20:48142205-48142227 CAGACTGTGTATGAGGAGGGAGG - Intergenic
1174184998 20:48700065-48700087 CTGAGTAGGTAGATGGAGGCAGG - Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1178047977 21:28717123-28717145 CTGGGTTTGTAGAATGAGGGAGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181331774 22:22098431-22098453 CAGATTGTGTGGCAGGAGGGAGG + Intergenic
1181409108 22:22705582-22705604 CAGAGGATCTGGAAGGAGTGAGG - Intergenic
1182931879 22:34182113-34182135 CACAGTATGTAGCAAGAGGCAGG - Intergenic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
953178496 3:40574254-40574276 CAGAGAATGAGGGAGGAGGGAGG + Intronic
955887234 3:63613474-63613496 GAGAGAAGGAAGAAGGAGGGAGG + Intronic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
957002565 3:74903080-74903102 CAGAGTATATAAAATGAGGATGG + Intergenic
959356719 3:105340580-105340602 AAAAGTATTTAGAAGGAGGAGGG - Intergenic
960905936 3:122601421-122601443 GAGATTTTGGAGAAGGAGGGAGG - Intronic
961597706 3:128032062-128032084 CAGATAATGTAGAGGGAGGGGGG - Intergenic
962329124 3:134462090-134462112 CAGGGACTGTAAAAGGAGGGAGG - Intergenic
962345651 3:134617427-134617449 CAGGGGAGGTAGAAGGAGAGAGG + Intronic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
962816055 3:139001849-139001871 CAGAGGCTGGAGGAGGAGGGTGG - Intergenic
964710278 3:159664743-159664765 CAGAGTATGAAAAAGGCAGGAGG + Intronic
965618900 3:170622809-170622831 TAGCATATGTAAAAGGAGGGAGG - Intronic
966265617 3:178038387-178038409 CATAGTCTGTTGATGGAGGGAGG + Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
977033270 4:91915712-91915734 GAGATCATGTAGAAGGAGGGAGG + Intergenic
978134465 4:105240549-105240571 CACACTGTGTAGAAGGATGGAGG + Intronic
978481362 4:109194533-109194555 TGGAGTATATAGAAGGAGTGAGG + Intronic
979022949 4:115525565-115525587 GAGAGCAAGTAGAAGCAGGGTGG - Intergenic
982110913 4:152052894-152052916 CAGAGTATCTAGAATTTGGGAGG - Intergenic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
987330875 5:16856618-16856640 CAAAGTAAGTGGAAGAAGGGAGG + Intronic
987928807 5:24376329-24376351 CATAGTATGTAAAAGAAGGAAGG + Intergenic
990013340 5:51026976-51026998 GAGAGTCTGTTCAAGGAGGGAGG - Intergenic
990154236 5:52856606-52856628 CAGAGGAGGTAGAAGGGTGGTGG - Intronic
990341020 5:54823246-54823268 CAGAGTATGCAGAATGGGGGAGG + Intergenic
991235981 5:64397947-64397969 CAGAGTAGGTAATATGAGGGAGG + Intergenic
991639497 5:68738785-68738807 CAGAGTGTGTTGAAGCATGGAGG - Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
995352339 5:111193845-111193867 CAGAGTATGTAGAAGAGGGCAGG + Intergenic
995957331 5:117793821-117793843 CAGAGTATGAAGGGTGAGGGAGG - Intergenic
997026317 5:130066351-130066373 CATAGTATTCAAAAGGAGGGAGG - Intronic
997750291 5:136337864-136337886 AAGAGTATGTAGAAGAAGCTGGG + Intronic
997845758 5:137284474-137284496 CACAGGATTTAGAAGGAGAGGGG + Intronic
998794508 5:145803953-145803975 CAGAGTGTGTGGTAGCAGGGTGG - Intronic
1001945649 5:175775369-175775391 CAGAGTTTGGAAAAGGATGGGGG - Intergenic
1003727450 6:8781198-8781220 ATGAGTATGTAGGAGGAGGTGGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1007398474 6:41590353-41590375 CAGGGCAGGTAGGAGGAGGGTGG + Intronic
1008300444 6:49831487-49831509 CAGAGGACGTAGATGGAGGAGGG + Intergenic
1011325158 6:86142647-86142669 CAGAGGTTGGAGAAAGAGGGAGG + Intergenic
1011744600 6:90397290-90397312 CAGAGCAATTAGCAGGAGGGAGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016743972 6:147558599-147558621 CAGAGTTTCTAGGAGGACGGGGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017495059 6:154976440-154976462 CTGAGAATGTAGAAGGATGTTGG + Intronic
1017564831 6:155672304-155672326 CATAGTGTGTGGAAGGAGGTGGG + Intergenic
1017747280 6:157458161-157458183 CAGGGTAGGTAGAAGAAGGGAGG + Intronic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018789290 6:167134331-167134353 TAGAGTATGCAGAAGAAGCGTGG - Intronic
1020636735 7:10705001-10705023 CAGAGTATGTAGGGAGAGGAAGG - Intergenic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1020790857 7:12626839-12626861 CAGTGTATGTAGGGGGAGGGTGG + Intronic
1021547986 7:21837561-21837583 CAGGGGAGGTAAAAGGAGGGAGG + Intronic
1022526648 7:31042337-31042359 AAGAGTATCTGGAAGGAGGTTGG - Intergenic
1023560667 7:41470306-41470328 CAGAGTCTGAAGGAGGAGGGAGG - Intergenic
1023610825 7:41968564-41968586 AAGAAAATGTGGAAGGAGGGAGG - Intronic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1026056785 7:66991730-66991752 CAGAGTTTGCAAAAAGAGGGCGG + Intronic
1026458287 7:70591739-70591761 CAAAGTATGTTGCAGGTGGGGGG - Intronic
1026556366 7:71412107-71412129 TAGAGAATGTAGAAGGAAGAAGG - Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG + Intergenic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1031185228 7:118471330-118471352 CAGAGGATGTAGAAGAAAGAAGG + Intergenic
1032447664 7:131998623-131998645 CAGGGCATGGAGAAGGAGAGGGG + Intergenic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033463301 7:141567153-141567175 CAGAGTGTGTAGAATGAGAATGG - Intronic
1035913332 8:3593342-3593364 TAGAGTCTGGAGAAGGTGGGAGG + Intronic
1036425403 8:8641386-8641408 CAGAGTGTGTAGGAGGAGGGAGG - Intergenic
1038076444 8:24080432-24080454 CAGAAAATGTAAAAGGAGTGAGG - Intergenic
1038609739 8:29049354-29049376 CAGAGAAGGTAGAAGAAGAGAGG + Intronic
1039755755 8:40520066-40520088 CAGAGTATGGAGATGGTCGGAGG - Intergenic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1040989628 8:53335917-53335939 CAGAGTAGGCAGATGGGGGGTGG - Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1043264722 8:78250194-78250216 CAGAGAATCTAGTAGGAGGTGGG - Intergenic
1046078715 8:109344020-109344042 TAGAGTATGTGGAAGGAGCTTGG - Exonic
1046365728 8:113228645-113228667 CAGAATATGTGGGAGGTGGGAGG - Intronic
1048383119 8:133885850-133885872 GAGAGACTGGAGAAGGAGGGAGG + Intergenic
1048999284 8:139814402-139814424 CAGACTGTCTAGCAGGAGGGAGG + Intronic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050730539 9:8704238-8704260 CAGAGGATGGAGTGGGAGGGGGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052469017 9:28869422-28869444 CAGAGGATGAACAAGGAGTGGGG + Intergenic
1052835052 9:33244243-33244265 CAGTGTATGTAGAAAGAGTCAGG + Intronic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1054976665 9:71154550-71154572 TAGATTATTTTGAAGGAGGGAGG - Intronic
1055505818 9:76948051-76948073 CAGAGGCTGGGGAAGGAGGGTGG - Intergenic
1056248374 9:84721540-84721562 CAGAGTATGTTGAATGTGGTGGG + Intronic
1056631127 9:88293971-88293993 CAAAATATGTAGTAAGAGGGTGG + Intergenic
1057785093 9:98081381-98081403 CAGAATATGTAACAGGAGTGAGG + Intronic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1058671778 9:107366452-107366474 CAGAGTAAGAAGAACCAGGGAGG - Intergenic
1059814879 9:117901080-117901102 CTGAATATGTAGAAAGATGGAGG + Intergenic
1059844115 9:118252463-118252485 TAGAGTAAGTGGAAAGAGGGAGG - Intergenic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1186746245 X:12572655-12572677 CAAAGAATGTAGAAGGGTGGAGG - Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187987469 X:24829730-24829752 CTGTGTATTTAGGAGGAGGGAGG + Intronic
1188242956 X:27810990-27811012 CAGAGTATGCAGTTGGAGGGAGG - Intronic
1191675230 X:63785687-63785709 GGGAGTATGCAGAGGGAGGGTGG - Intergenic
1192656061 X:72996238-72996260 AAGAGGATATAGAAAGAGGGAGG + Intergenic
1192666059 X:73086763-73086785 AAGAGGATATAGAAAGAGGGAGG - Intergenic
1192916126 X:75652741-75652763 GAGAGTGAGTAGAAGCAGGGTGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193998546 X:88397906-88397928 AATACTATGTAGAAGAAGGGAGG - Intergenic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1195683235 X:107564226-107564248 CAGTGTATGAAGGAGGTGGGAGG - Intronic
1196361082 X:114859706-114859728 CAAAGTAAGTAGAAAGAAGGAGG - Intronic
1197535222 X:127679030-127679052 TAGAGGAAGTAGAAGGAGAGTGG + Intergenic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1199025763 X:142935576-142935598 GAGAGTAGGTAGAAAGAGAGTGG - Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic