ID: 1199717313

View in Genome Browser
Species Human (GRCh38)
Location X:150515827-150515849
Sequence GGGCACTGTCACTCCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199717313_1199717320 18 Left 1199717313 X:150515827-150515849 CCTTCAAAGGAGTGACAGTGCCC No data
Right 1199717320 X:150515868-150515890 CCCCTCAACCCAGAGCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199717313 Original CRISPR GGGCACTGTCACTCCTTTGA AGG (reversed) Intergenic
No off target data available for this crispr