ID: 1199717320

View in Genome Browser
Species Human (GRCh38)
Location X:150515868-150515890
Sequence CCCCTCAACCCAGAGCAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199717315_1199717320 -3 Left 1199717315 X:150515848-150515870 CCTGCTTCACCTCCCACTCACCC No data
Right 1199717320 X:150515868-150515890 CCCCTCAACCCAGAGCAATCTGG No data
1199717311_1199717320 22 Left 1199717311 X:150515823-150515845 CCACCCTTCAAAGGAGTGACAGT No data
Right 1199717320 X:150515868-150515890 CCCCTCAACCCAGAGCAATCTGG No data
1199717314_1199717320 -2 Left 1199717314 X:150515847-150515869 CCCTGCTTCACCTCCCACTCACC No data
Right 1199717320 X:150515868-150515890 CCCCTCAACCCAGAGCAATCTGG No data
1199717313_1199717320 18 Left 1199717313 X:150515827-150515849 CCTTCAAAGGAGTGACAGTGCCC No data
Right 1199717320 X:150515868-150515890 CCCCTCAACCCAGAGCAATCTGG No data
1199717312_1199717320 19 Left 1199717312 X:150515826-150515848 CCCTTCAAAGGAGTGACAGTGCC No data
Right 1199717320 X:150515868-150515890 CCCCTCAACCCAGAGCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199717320 Original CRISPR CCCCTCAACCCAGAGCAATC TGG Intergenic
No off target data available for this crispr