ID: 1199720011

View in Genome Browser
Species Human (GRCh38)
Location X:150536724-150536746
Sequence CACCCTGGGAAGCCTGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199720011_1199720019 21 Left 1199720011 X:150536724-150536746 CCCAGTCCAGGCTTCCCAGGGTG No data
Right 1199720019 X:150536768-150536790 TGTCGTTGAGTTAGAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199720011 Original CRISPR CACCCTGGGAAGCCTGGACT GGG (reversed) Intergenic
No off target data available for this crispr